ORFeome > irf1 ORF1 – XORFeome v1.0

irf1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: irf1
Gene ID: 6255163
Gene Page ID: 942993
ORF Xenbase ID: 17280531

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC059984
Original XGC clone length: 897

Human orthology & disease relationships

NCBI Entrez ID: 3659
Ensembl gene IDs: ENSG00000125347
Directly associated (OMIM) disease MIM numbers: 211980,613659
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11019
Well Location: C07

Sequences - 5ʹ (forward) EST

Accession: JZ824511
dbEST ID: 79642213
Trimmed Sequence: ATGCCTGTGACACGTTTAAGGATGAGGCCATGGCTAGAGGAGCAGATAAACTCCAACAAAATCCCTGGATTGTCATGGATCAACAAGGATAAAATGATATTCCAGATCCCTTGGAAACATGCTGCTAGACATGGATGGGACATCAATAAAGATGCCTGCCTTTTCCGGAGTTGGGCTGTCCATACAGGACGTTTTAAATCTGGCGAGAAGGAGACCGACCCTAAAACTTGGAAGGCCAATTTCCGATGCGCAATGAACTCTCTGCCGGATATAAAAGAAGTCAAAGACAAAAGCATATACAAAGGCTCCAGTGCAGTGCGAGTATATCAGATGTTCACACCTCAAATAAAGGCTGAGAAGAAAGAGCGCAGATCCAAGGCAAAATGCTCTAAAAGCAAAGCCAAGTATAAGACTGAGGAAGACGAGGAATCTGTAAAAACTAGCCCATTGCCTGTAGACCACAGCTACACTGCTAATGTATATACAGACCAAGAAGACATGGATTCTGTGGATGCAGCTGTAATGAGCCTCAACGAAAGTGTCTCTACACCTTTGGGAACTGGGACTCTCAACTTGAAATGCCATTGCCTGACAGCACAAATAACCTCTACCCTTTCCAGGTGTCACCCTTGAGTTCATCTTCGGAAGAGGAAGAAGACTTTCCAGACGACTTTCTTAGGATGATGTTAGAGCCAAGCACAGAATGGCAGCAGACAAGCATAGATGGGCAAAGGGTTTTTTCACCATTTGAATCTGGGTATGCAAAACCGGCCTGNTCTAACCTTGAAAATAAGGCTTCTGCAAATTCCAACCG
Full Trace Sequence: CCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCTGTGACACGTTTAAGGATGAGGCCATGGCTAGAGGAGCAGATAAACTCCAACAAAATCCCTGGATTGTCATGGATCAACAAGGATAAAATGATATTCCAGATCCCTTGGAAACATGCTGCTAGACATGGATGGGACATCAATAAAGATGCCTGCCTTTTCCGGAGTTGGGCTGTCCATACAGGACGTTTTAAATCTGGCGAGAAGGAGACCGACCCTAAAACTTGGAAGGCCAATTTCCGATGCGCAATGAACTCTCTGCCGGATATAAAAGAAGTCAAAGACAAAAGCATATACAAAGGCTCCAGTGCAGTGCGAGTATATCAGATGTTCACACCTCAAATAAAGGCTGAGAAGAAAGAGCGCAGATCCAAGGCAAAATGCTCTAAAAGCAAAGCCAAGTATAAGACTGAGGAAGACGAGGAATCTGTAAAAACTAGCCCATTGCCTGTAGACCACAGCTACACTGCTAATGTATATACAGACCAAGAAGACATGGATTCTGTGGATGCAGCTGTAATGAGCCTCAACGAAAGTGTCTCTACACCTTTGGGAACTGGGACTCTCAACTTGAAATGCCATTGCCTGACAGCACAAATAACCTCTACCCTTTCCAGGTGTCACCCTTGAGTTCATCTTCGGAAGAGGAAGAAGACTTTCCAGACGACTTTCTTAGGATGATGTTAGAGCCAAGCACAGAATGGCAGCAGACAAGCATAGATGGGCAAAGGGTTTTTTCACCATTTGAATCTGGGTATGCAAAACCGGCCTGNTCTAACCTTGAAAATAAGGCTTCTGCAAATTCCAACCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTGTGACACGTTTAAGGA

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: CGGGAGGGAAACCGCGATCACCTATGACATGTACTCAGACTCAGTGTAGGGGATATGGGCGTGGATGGATAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAAAGTGGGGACAGCTAATCCTGTAGCCCTTGAGGAATAGTCGGGCCAGTTGATCAAGTCTGTGGAGAATCTGACTTTTATTTCACCTGATAACGTGCCGTCGAATGCAGAGCTTATTTCAGTTAGACAGGCGTTCTGCATACCAGATTCATTGGTGAAAAACCCTTTGCCATCTATGCTTGTCTGCTGCCATTCTGTGCTTGGCTCTAACATCATCCCAACAAAATCATCTGGAAAGTCTTCTTCCTCTTCCGAAGATCAACTCAAGGGTGACACCTGGAAAGGGTAGAGGTTAATTGTGCTGTCACGCAATGGCATTTCAAGTTGAGATTCCCATTCCAAGGTGCTAGACACACTTTCATTGAGGCTCACTACATCTGCATCCACACAATCAATGTCTTCTTGTTCTGCATATACATTATCAATGTAGCTGTGGTCTACACGCAATGCGCTAGTTATTTACCTACTCCTCGTCATCCTCACTCTTAAGCTTCACTTGCCTTTAATAGCAATCAGCCTTGAATCCACGCTCATGCTCCTCCCCCTTTATTTCAGGGTGTAAACACCTGAATAAACTCCCCCCGCCATGGGAACCCTTCGTTCACAGCTATTAATCTTTAAACTTATTTTTTTTTCCCGGCCAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAAAGTGGGGACAGCTAATC