ORFeome > irf3 ORF1 – XORFeome v1.0

irf3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: irf3
Gene ID: 1013734
Gene Page ID: 1013732
ORF Xenbase ID: 17280567

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC045003
Original XGC clone length: 1401

Human orthology & disease relationships

NCBI Entrez ID: 3661
Ensembl gene IDs: ENSG00000126456
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 142680,151623,173100,180849,209950,219050,262400,262650,266600,274500,275355,308230,600802,601665,606843,609135

Library Location

Plate ID: GDExl11012
Well Location: A07

Sequences - 5ʹ (forward) EST

Accession: JZ824024
dbEST ID: 79641726
Trimmed Sequence: ATGGGCTCACAGAAGCCACGGATTATCCCATGGTTAATCAGCCAGATTGGTAACCCAGCATACCCGGGCCTGATTTGGATGAATGAAGAAAAGACCAGGTTTCGTATCCCTTGGAAACATGGATTGCGTCAGGACAGATGTGATGCTGATGTCAAAATATTTGAGGGCTGGGCTATTGTCAGTGGTTCCTATGACCCCAGCAAGGATCAGCCTAACCCAGCGGTGTGGAAAAGGAATTTCCGCTCGGCACTGAATCGCAAGGCTGGCATCAATGTGATGGTAGACAAGAGCTCGGAGTCTGTTAACCCTCACAAGGTCTATGAGATCCAAAAAGGGATCAGCGTGGAGGGTGATGTTGGCTCTGAAGAGACTTATATGAATGACAGCATTAGCCCTTCTTCTGATTTATTCTCAATAAACAGCCCCAGGAGCAACACAAGCAGCAATATGAATGCAACCCTATCAGAAGGCATAATGCAGCTACAGCTCTCTCATACTGAAGAAGATCTATACTGTTCCCCTGAAGACAACCAAGCCATGCCATATAGAGATCCATATAACTCTCAGGAAAGCTGGTTCTCTGGCATTTCCTCCCCGGAGAGGGTTGGAGATGCTGATACCCCTGCATACAGTACAGCTCCTGTGCACATGGGGGCACATGCTGAAGCCTTACCCGGCGGAGGTCGCCACAAATCAAGGGAGTCCACTACAGCAACCTATCCACTGGATCATTTTTTCCAAGAAAGAGGAATTTAAGGAGAAAAATTTTAAAATGACCGGGAATTTTAAAAAGGAAAACCTAAAATTTTTTAAAAAACCTTGGTGAA
Full Trace Sequence: ATTGATTTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGCTCACAGAAGCCACGGATTATCCCATGGTTAATCAGCCAGATTGGTAACCCAGCATACCCGGGCCTGATTTGGATGAATGAAGAAAAGACCAGGTTTCGTATCCCTTGGAAACATGGATTGCGTCAGGACAGATGTGATGCTGATGTCAAAATATTTGAGGGCTGGGCTATTGTCAGTGGTTCCTATGACCCCAGCAAGGATCAGCCTAACCCAGCGGTGTGGAAAAGGAATTTCCGCTCGGCACTGAATCGCAAGGCTGGCATCAATGTGATGGTAGACAAGAGCTCGGAGTCTGTTAACCCTCACAAGGTCTATGAGATCCAAAAAGGGATCAGCGTGGAGGGTGATGTTGGCTCTGAAGAGACTTATATGAATGACAGCATTAGCCCTTCTTCTGATTTATTCTCAATAAACAGCCCCAGGAGCAACACAAGCAGCAATATGAATGCAACCCTATCAGAAGGCATAATGCAGCTACAGCTCTCTCATACTGAAGAAGATCTATACTGTTCCCCTGAAGACAACCAAGCCATGCCATATAGAGATCCATATAACTCTCAGGAAAGCTGGTTCTCTGGCATTTCCTCCCCGGAGAGGGTTGGAGATGCTGATACCCCTGCATACAGTACAGCTCCTGTGCACATGGGGGCACATGCTGAAGCCTTACCCGGCGGAGGTCGCCACAAATCAAGGGAGTCCACTACAGCAACCTATCCACTGGATCATTTTTTCCAAGAAAGAGGAATTTAAGGAGAAAAATTTTAAAATGACCGGGAATTTTAAAAAGGAAAACCTAAAATTTTTTAAAAAACCTTGGTGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGCTCACAGAAGCCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ829332
dbEST ID: 79647034
Trimmed Sequence: TTCAAAGTCCATCATCTCGTGGAGTTCTCGTAGAACAGCCATCACGTCATTTGTACTGGAGAGAGAGTCTGAGATTTCCAGGTTAATCTCACTGCTATGGAGAGAAGAGGCTCCCGTACTGTAACTCATGTCATGAAGCAACTTCATTGACACAGGTACAATCTGCACCATGATGAATTTTTTATTCCATGGCCGAACATCAGGCCACAGTTCTCCAAGGCACATCCAAATGTGGTACTGAGGGGAGGACTTCCTGGTGCGTTCGATGAATTCAGTCAGTTCTGCTACAAACTGCTGCAGTGTGTGCAGAATGCAGTAGTCGTTTTTGTCAATCTGGTTGGGTTGACTGATTTCAGGCATCTCGGTCATGCTCCAAAAAGCCCTGCACTTTCCTTGCCTCTTCCCACAGATGGAGCCTCCTCTCACCTCGACCAAGACCCCTTCTTCTAAGTTCCGCAACAGTTTGTGTATTTCACCCACAACAGCCTGATCGGCAATCATTGTTGGCGATGGCAGAACCACATCGTCCAAGTAGCTGCCTGGTGATGAGTGTTTTCTCGATGTAATGCGGAAGCCGTGTGGGTTTTTTACCAGAGTTTTACTAACTTCGATTCCTCTGTAATATACAGTCACTTCGAATTTCTGTCCTTAATGTCCTGTCTTGGAAAAATGATCAGTGATATGTTTGCTGTAGTGGAACTTCCTTGATTTGTGGGCGACCCTCCCGCCGGTAAAGGCTTCCAGCCATGGGGCCCCCCCTGGTTGCAC
Full Trace Sequence: TGCCGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCAAAGTCCATCATCTCGTGGAGTTCTCGTAGAACAGCCATCACGTCATTTGTACTGGAGAGAGAGTCTGAGATTTCCAGGTTAATCTCACTGCTATGGAGAGAAGAGGCTCCCGTACTGTAACTCATGTCATGAAGCAACTTCATTGACACAGGTACAATCTGCACCATGATGAATTTTTTATTCCATGGCCGAACATCAGGCCACAGTTCTCCAAGGCACATCCAAATGTGGTACTGAGGGGAGGACTTCCTGGTGCGTTCGATGAATTCAGTCAGTTCTGCTACAAACTGCTGCAGTGTGTGCAGAATGCAGTAGTCGTTTTTGTCAATCTGGTTGGGTTGACTGATTTCAGGCATCTCGGTCATGCTCCAAAAAGCCCTGCACTTTCCTTGCCTCTTCCCACAGATGGAGCCTCCTCTCACCTCGACCAAGACCCCTTCTTCTAAGTTCCGCAACAGTTTGTGTATTTCACCCACAACAGCCTGATCGGCAATCATTGTTGGCGATGGCAGAACCACATCGTCCAAGTAGCTGCCTGGTGATGAGTGTTTTCTCGATGTAATGCGGAAGCCGTGTGGGTTTTTTACCAGAGTTTTACTAACTTCGATTCCTCTGTAATATACAGTCACTTCGAATTTCTGTCCTTAATGTCCTGTCTTGGAAAAATGATCAGTGATATGTTTGCTGTAGTGGAACTTCCTTGATTTGTGGGCGACCCTCCCGCCGGTAAAGGCTTCCAGCCATGGGGCCCCCCCTGGTTGCAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCAAAGTCCATCATCTCGTG