ORFeome > irf6.2 ORF2 – XORFeome v1.0

irf6.2 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: irf6.2
Gene ID: 5910427
Gene Page ID: 5910330
ORF Xenbase ID: 17280591

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108593
Original XGC clone length: 1380

Human orthology & disease relationships

NCBI Entrez ID: 3664
Ensembl gene IDs: ENSG00000117595
Directly associated (OMIM) disease MIM numbers: 119300,119500,608864
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: G10

Sequences - 5ʹ (forward) EST

Accession: JZ837995
dbEST ID: 79655697
Trimmed Sequence: ATGGCTATGCACCCCCGTCGTGTTCGGCTTAAACCATGGCTGGTGGCCCAGGTCGATAGCGGAATGTACCCTGGTCTCATCTGGTTAAACAGAGAAGCCAAAAGGTTCCAGATCCCCTGGAAACATGCCACAAGGCATAGCCCCCGTCAGGAAGAAGAAAACACAATATTTAAGGCTTGGGCTGTTGAGACAGGCAAATACCAAGAAGGAGCTGATGAACCAGACCCAGCCAAGTGGAAGGCCCAACTGCGCTGTGCACTGAACAAGAGCAGAGAGTTTAAACTTATGTATGATGGGACCAAAGAGGTTCCTATGAACCCAGTCAAAATCTACGAGGTGTGCGACATCCCCCAGTCTCAAGGATCTATCATCAACCCAGGTTCCACAGGATCTGTACCATGGGATGATGATGATTTTGAAGCGGATGAACTAAATCANTCCCAGAACCATGTACCAATCAGTGAGCCCTTTAACTGTCTAAATATTAATGACTCGCCCATCGGATCATCTAGTACAGGCAGCTGCACCCCTGAGCAAACATGGCCAAAGACTGAACCTCAGGAGATGGAAGTGCCCCCCACATCANGCCCTGCTGAATTTTTCAATTCTCCCGAAATGTGGATCAGTTCCCTACCAATGACTGACTTAAAAATTCCATTTTACTACCGAAGGAAAAAAAATGGGTCAGAACATTGAAAATCAGTAATCCTTAAAGGTCTCCCCGCTTTTCTATGGTTTAACCTGGAAACAATGGCCCATCCCGGAAAAACCCTGTTTTGAACCCATCCCCCCCTTTAAAAAAATTCCCCATTTC
Full Trace Sequence: TCGGGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTATGCACCCCCGTCGTGTTCGGCTTAAACCATGGCTGGTGGCCCAGGTCGATAGCGGAATGTACCCTGGTCTCATCTGGTTAAACAGAGAAGCCAAAAGGTTCCAGATCCCCTGGAAACATGCCACAAGGCATAGCCCCCGTCAGGAAGAAGAAAACACAATATTTAAGGCTTGGGCTGTTGAGACAGGCAAATACCAAGAAGGAGCTGATGAACCAGACCCAGCCAAGTGGAAGGCCCAACTGCGCTGTGCACTGAACAAGAGCAGAGAGTTTAAACTTATGTATGATGGGACCAAAGAGGTTCCTATGAACCCAGTCAAAATCTACGAGGTGTGCGACATCCCCCAGTCTCAAGGATCTATCATCAACCCAGGTTCCACAGGATCTGTACCATGGGATGATGATGATTTTGAAGCGGATGAACTAAATCANTCCCAGAACCATGTACCAATCAGTGAGCCCTTTAACTGTCTAAATATTAATGACTCGCCCATCGGATCATCTAGTACAGGCAGCTGCACCCCTGAGCAAACATGGCCAAAGACTGAACCTCAGGAGATGGAAGTGCCCCCCACATCANGCCCTGCTGAATTTTTCAATTCTCCCGAAATGTGGATCAGTTCCCTACCAATGACTGACTTAAAAATTCCATTTTACTACCGAAGGAAAAAAAATGGGTCAGAACATTGAAAATCAGTAATCCTTAAAGGTCTCCCCGCTTTTCTATGGTTTAACCTGGAAACAATGGCCCATCCCGGAAAAACCCTGTTTTGAACCCATCCCCCCCTTTAAAAAAATTCCCCATTTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTATGCACCCCCGTC

Sequences - 3ʹ (reverse) EST

Accession: JZ837994
dbEST ID: 79655696
Trimmed Sequence: CTGGGCTTGGAGCATCTGTGCCAGGTGCATGTTTTGGGGCTGCATGAGAGGCCAAGCATCTGGGCCTTGATGGTTCTGAAGAAGGCGATACAGATGTTTTAGGTGAGAAACAATGTTGTCTTTGATATCAGGGATGGAAATCTGTAGACGGATGCTTCCACTGTCAAAGGAACGGGTGCTATCTCCAGTAAACATCTCGATTATCATGCGTGCTACAATTGGTATTATCTGAACAATTATGAGCTTTCTTTCTTTAGATTTGCCATCTGGCCACTCCTCTCCGAAGCCCAAGTAGATTTCATAGGGCGGTTGTTTTGTAATGATCCCCTTTTGGTGTGAAATAAGATCACTTAGGAAAGTCTCCAGACAGAAAAGTTTAACTCTCTTCTGCCTTTCAATAAAGTTTGGGGTAGTGGGAGATGATAAGCAGGGCCCGCTCCACTACACTTTACACTGACACAATCTGATTGCATATGTGGCATGCCCGCTGACTTCGGATATCAGACCCCTCTCCCTGGACTCGAGAGGACCAACAATAAAAAGCTTCTGTTTTTTTTTTACTATTTATTTTTTCCGGCCAACTCGAGCGAAATGGTGGGGAATGGGGGGGGGTGCCCTCCAGAGTGGGTAGTGGGGGGGGGGGCCGAAGAAGATACAACAGCCGGGGGGGGTGCGGGATGGAGGTGGCGGGGGCGGGCGGGTGCCCTTTTTATTAACCTTGAAATTGCGAATCATTTCCTTGGTTGGGTTTGATTTGTGCGGGG
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGGGCTTGGAGCATCTGTGCCAGGTGCATGTTTTGGGGCTGCATGAGAGGCCAAGCATCTGGGCCTTGATGGTTCTGAAGAAGGCGATACAGATGTTTTAGGTGAGAAACAATGTTGTCTTTGATATCAGGGATGGAAATCTGTAGACGGATGCTTCCACTGTCAAAGGAACGGGTGCTATCTCCAGTAAACATCTCGATTATCATGCGTGCTACAATTGGTATTATCTGAACAATTATGAGCTTTCTTTCTTTAGATTTGCCATCTGGCCACTCCTCTCCGAAGCCCAAGTAGATTTCATAGGGCGGTTGTTTTGTAATGATCCCCTTTTGGTGTGAAATAAGATCACTTAGGAAAGTCTCCAGACAGAAAAGTTTAACTCTCTTCTGCCTTTCAATAAAGTTTGGGGTAGTGGGAGATGATAAGCAGGGCCCGCTCCACTACACTTTACACTGACACAATCTGATTGCATATGTGGCATGCCCGCTGACTTCGGATATCAGACCCCTCTCCCTGGACTCGAGAGGACCAACAATAAAAAGCTTCTGTTTTTTTTTTACTATTTATTTTTTCCGGCCAACTCGAGCGAAATGGTGGGGAATGGGGGGGGGTGCCCTCCAGAGTGGGTAGTGGGGGGGGGGGCCGAAGAAGATACAACAGCCGGGGGGGGTGCGGGATGGAGGTGGCGGGGGCGGGCGGGTGCCCTTTTTATTAACCTTGAAATTGCGAATCATTTCCTTGGTTGGGTTTGATTTGTGCGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGGGCTTGGAGCATCTGT