ORFeome > irx1 ORF1 – XORFeome v1.0

irx1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: irx1
Gene ID: 6254076
Gene Page ID: 486816
ORF Xenbase ID: 17280627

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC110767
Original XGC clone length: 1389

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: H05

Sequences - 5ʹ (forward) EST

Accession: JZ837977
dbEST ID: 79655679
Trimmed Sequence: ATGTCCTTCCCGCAGCTGGGTTACCCCCAGTACCTGACCGCCGGCCAGGGTGCAGTCTATGGCGGCGAACGGCCGGGCGTTTTAGCCGCGGCAGCAGCAGCAGCCGCAGCAGCCGGAAGGCCAACAGGAGCTGAGCTGGGCAGCTGTCCTACCGCGGCAGTCACCTCAGTGCTGGGCATGTATGCCAGCCCGTACAGCTCTCCCAACTACAGCGCCTTTCTGCCATACACAACCGATCTCACCCTTTTCTCCCAAATGGGATCGCAGTATGAACTGAAAGACAACCCTGGTGTCCACCCAGCTACGTTTGCTGCGCACACTACTCCAGGCTATTACCCCTATGGGCAGTTCCAGTATGGAGACCCAGGGCGGCCAAAGAATGCCACCAGGGAGAGCACCAGCACCCTAAAGGCTTGGCTCAACGAGCACAGAAAGAACCCATACCCCACCAAGGGGGAGAAGATCATGCTGGCGATAATCACCAAGATGACCCTCACCCAGGTCTCCACGTGGTTTGCCAACGCCAGGAGGAGACTAAAAAAAGAGAATTAAGTCACTTGGGGGGGGATGGGGAAGGAGGATGAAAACATCTTTGGTAGGTGATAATGAGGGAGACCATGAAAAAAATGAAAATGACCAAGAAGATAAACTTGGAAAGAATAAATATAGAAAGGATTAATGAGGACAACCGGTGAACAAACCAACCAACGAGAAGGAGGAGAAACGGGAAGCGGTTTTAGACATTGTTCAAGAAAGAAATTTTTTAAATAGAGGAAAATGAGAGGGGAGGGGGTTCGAGGGTTTCCCAAACCGGCATTTAAC
Full Trace Sequence: CGCGGCACAAATAANTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCTTCCCGCAGCTGGGTTACCCCCAGTACCTGACCGCCGGCCAGGGTGCAGTCTATGGCGGCGAACGGCCGGGCGTTTTAGCCGCGGCAGCAGCAGCAGCCGCAGCAGCCGGAAGGCCAACAGGAGCTGAGCTGGGCAGCTGTCCTACCGCGGCAGTCACCTCAGTGCTGGGCATGTATGCCAGCCCGTACAGCTCTCCCAACTACAGCGCCTTTCTGCCATACACAACCGATCTCACCCTTTTCTCCCAAATGGGATCGCAGTATGAACTGAAAGACAACCCTGGTGTCCACCCAGCTACGTTTGCTGCGCACACTACTCCAGGCTATTACCCCTATGGGCAGTTCCAGTATGGAGACCCAGGGCGGCCAAAGAATGCCACCAGGGAGAGCACCAGCACCCTAAAGGCTTGGCTCAACGAGCACAGAAAGAACCCATACCCCACCAAGGGGGAGAAGATCATGCTGGCGATAATCACCAAGATGACCCTCACCCAGGTCTCCACGTGGTTTGCCAACGCCAGGAGGAGACTAAAAAAAGAGAATTAAGTCACTTGGGGGGGGATGGGGAAGGAGGATGAAAACATCTTTGGTAGGTGATAATGAGGGAGACCATGAAAAAAATGAAAATGACCAAGAAGATAAACTTGGAAAGAATAAATATAGAAAGGATTAATGAGGACAACCGGTGAACAAACCAACCAACGAGAAGGAGGAGAAACGGGAAGCGGTTTTAGACATTGTTCAAGAAAGAAATTTTTTAAATAGAGGAAAATGAGAGGGGAGGGGGTTCGAGGGTTTCCCAAACCGGCATTTAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCTTCCCGCAGCTGGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ837976
dbEST ID: 79655678
Trimmed Sequence: GGCAGAGGGAAGTGCTGTCAGTATACGAGAGGTGCCTTCTTGTTGGGAAAAGGTCTTTTCACGAACAGCTTGGAAGGAAGGTTTTAACTGAGGTGGTGATTCGGTTCTGGGTAAATTTTCTCTGTCTGAGTGCTTGGGACTGGTCCTCTCTGGAGTTCTGTCGCTACTGAGGGAACCCAGGTTTGTTGCTAACAATGTAGATTGTTGGTGAGCCTGAAGGTGGTGGTGGTTATGGTGAGCCGCATGGTGAGGGTTTACTCCCAACAAGGATCTCATGTTTATCATAGAGCTCTGTGTGAGAAAAGCCCCGTTTGTCCAGTTGTGAAATTTGCCAATTTGACATGTGTATAGTCCATGGCTGGGGAGAAAGGCTGGGTGCTGCATTTGGGGAGATGTGTGATTGGCTTGAGAAGGTGAAGGAGAAAACATCAACGCCCCATCTGCCCTCGTTGGTGTCTCTGCCTTGGACCACATTTTAGGGTTAATGTGAAGTGGGGCTTGTGTGTTGGGGGGGGCTGCGGGGCTGACGATGATACAACTGCTGGGGGGGGAAGCGGGGATTACTCACGAAAAATAAAGGCGAAAAGGGTAAATTAATTGGGGAAGAGAGAAACGTGGGCAGGGGGCCACGTGGGCGAAACGTAACATATCACCACCTGCACGAGAGATGGGGGGGGGGTTGGGCGGGGGCCCCCACCTTTCCACAGTGCATCTACCGTGGGGGGGGGGGAGGGGGGGGGGGGGGGGGGGTGTCTTATGGTCGGGGCGAAGGATGCA
Full Trace Sequence: AAACAGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGCAGAGGGAAGTGCTGTCAGTATACGAGAGGTGCCTTCTTGTTGGGAAAAGGTCTTTTCACGAACAGCTTGGAAGGAAGGTTTTAACTGAGGTGGTGATTCGGTTCTGGGTAAATTTTCTCTGTCTGAGTGCTTGGGACTGGTCCTCTCTGGAGTTCTGTCGCTACTGAGGGAACCCAGGTTTGTTGCTAACAATGTAGATTGTTGGTGAGCCTGAAGGTGGTGGTGGTTATGGTGAGCCGCATGGTGAGGGTTTACTCCCAACAAGGATCTCATGTTTATCATAGAGCTCTGTGTGAGAAAAGCCCCGTTTGTCCAGTTGTGAAATTTGCCAATTTGACATGTGTATAGTCCATGGCTGGGGAGAAAGGCTGGGTGCTGCATTTGGGGAGATGTGTGATTGGCTTGAGAAGGTGAAGGAGAAAACATCAACGCCCCATCTGCCCTCGTTGGTGTCTCTGCCTTGGACCACATTTTAGGGTTAATGTGAAGTGGGGCTTGTGTGTTGGGGGGGGCTGCGGGGCTGACGATGATACAACTGCTGGGGGGGGAAGCGGGGATTACTCACGAAAAATAAAGGCGAAAAGGGTAAATTAATTGGGGAAGAGAGAAACGTGGGCAGGGGGCCACGTGGGCGAAACGTAACATATCACCACCTGCACGAGAGATGGGGGGGGGGTTGGGCGGGGGCCCCCACCTTTCCACAGTGCATCTACCGTGGGGGGGGGGGAGGGGGGGGGGGGGGGGGGGTGTCTTATGGTCGGGGCGAAGGATGCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCAGAGGGAAGTGCTGT