ORFeome > irx3 ORF1 – XORFeome v1.0

irx3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: irx3
Gene ID: 480490
Gene Page ID: 480485
ORF Xenbase ID: 17280639

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108595
Original XGC clone length: 1347

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: G09

Sequences - 5ʹ (forward) EST

Accession: JZ837979
dbEST ID: 79655681
Trimmed Sequence: ATGTCCTTCCCACAGCTGGGCTACCAGTACATCAGACCTCTGTACCCCTCGGACAGACAGAGCGTGGGGGTAACCAGGAGCGGAACTGAGCTGTCTCCGGCAGGGACTCTTTCTAATGTACTTTCCTCCGTGTATGGAGCACCCTACGCTGCAGCCGCCGCAGCACAAGCCTATGGAGCCTTCCTGCCCTACAGCGCGGAGCTGCCCATCTTCCCCCAGCTGGGTTCACAGTATGACATGAAGGACAGTCCTGGGGTCCAGCATGCCGCTTTATCCTCATCCTT
Full Trace Sequence: GGGGGTCAAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCTTCCCACAGCTGGGCTACCAGTACATCAGACCTCTGTACCCCTCGGACAGACAGAGCGTGGGGGTAACCAGGAGCGGAACTGAGCTGTCTCCGGCAGGGACTCTTTCTAATGTACTTTCCTCCGTGTATGGAGCACCCTACGCTGCAGCCGCCGCAGCACAAGCCTATGGAGCCTTCCTGCCCTACAGCGCGGAGCTGCCCATCTTCCCCCAGCTGGGTTCACAGTATGACATGAAGGACAGTCCTGGGGTCCAGCATGCCGCTTTATCCTCATCCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCAAAACACAAAAACACAAATGTTACATTAATAATTTTTGAAGCCGCCGAAAAAAAAAAACAAGAAAAAAAATAACACACAGGGCCCCTCGTAGACACCGCGTGAAAAGAAGGCGAGCCACCCGCAAAGCACCACGGGGGGGCGGGGTGAAACTATGGTGGGAAAAAGGGCGGAGGGCGCCACACCGCGGAGAACTTAACCCCGGGTCGGGGGTGGGAAAGCGGGGAGGGGGTTTTGGCGGTTGGTTTCCTTTTTTTTTGGGGTTAACAAATTCTTTGAGCAAACCCCCCCGGGGGGGGGAGACCGGGGGGGAGGGGGTGGGTTTTTTTTGTGGGCTGTATTTATTTTAAATGAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCTTCCCACAGCTGGGCTA

Sequences - 3ʹ (reverse) EST

Accession: JZ837978
dbEST ID: 79655680
Trimmed Sequence: GGATGAGGATAAAGCGGCATGCTGGACCCCAGGACTGTCCTTCATGTCATACTGTGAACCCAGCTGGGGGAAGATGGGCAGCTCCGCGCTGTAGGGCAGGAAGGCTCCATAGGCTTGTGCTGCGGCGGCTGCAGCGTAGGGTGCTCCATACACGGAGGAAAGTACATTAGAAAGAGTCCCTGCCGGAGACAGCTCAGTTCCGCTCCTGGTTACCCCCACGCTCTGTCTGTCCGAGGGGTACAGAGGTCTGATGTACTGGTAGCCCAGCTGTGGGAAGGACATGG
Full Trace Sequence: GAACAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGATGAGGATAAAGCGGCATGCTGGACCCCAGGACTGTCCTTCATGTCATACTGTGAACCCAGCTGGGGGAAGATGGGCAGCTCCGCGCTGTAGGGCAGGAAGGCTCCATAGGCTTGTGCTGCGGCGGCTGCAGCGTAGGGTGCTCCATACACGGAGGAAAGTACATTAGAAAGAGTCCCTGCCGGAGACAGCTCAGTTCCGCTCCTGGTTACCCCCACGCTCTGTCTGTCCGAGGGGTACAGAGGTCTGATGTACTGGTAGCCCAGCTGTGGGAAGGACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAATAACTGAAAATCATAAAACAAAAAAATTAATCAGATGTTCCTCAAACCCACCGGCAAAAAAAAACAAAAACGTCAATCCTAACAAAGGGACCTGGGGTAACCTTCTTTGTAATAAAAAAAACACAAAACCACAAAAAAAAAACCCAGGTGCGGTCTTAATCTTTAGGGGATGAACTTGCGCGCCGACCCACCTGGGCAAAAACAAAACACAACACCGCGGGGGGAAGGGGGCAGTGGGGGGGTTTGGGTGTCTGTTCCCCGTGGTTTTGGTGGGCACATCAACCCCCTGGGGCGCGCCCCCCCAGCGGGACTGTCCCCCGGCGGGCGTGGTGTTGTTTGTTTGTGGTTTTTTATTTGTAATTNTCTTATTTTTTTATTTATNNNCGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGATGAGGATAAAGCGGA