ORFeome > iscu ORF1 – XORFeome v1.0

iscu ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: iscu
Gene ID: 946412
Gene Page ID: 946405
ORF Xenbase ID: 17280645

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054995
Original XGC clone length: 324

Human orthology & disease relationships

NCBI Entrez ID: 23479
Ensembl gene IDs: ENSG00000136003
Directly associated (OMIM) disease MIM numbers: 255125
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: E03

Sequences - 5ʹ (forward) EST

Accession: JZ839457
dbEST ID: 79657159
Trimmed Sequence: ATGGCTGGTGTGAGTCGGGTGTTTTGCTCGTTATGGAGAAGATGCGGGGTGCAGGAGCTTCGGGTGCCTTGCGCTTCTTATCATAAGAAGGTAGTTGATCATTATGAAAATCCAAGAAATGTTGGATCCCTTGACAAGAATGCAAAGAATGTTGGGACAGGTTTGGTGGGCGCACCAGCATGCGGTGATGTCATGAAACTACAGATTGAAGTGGATGACAATGGAAAAATTATTGAAGCCAAGTTCAAAACGTTTGGTTGTGGGTCTGCCATTGCCTCCAGTTCTCTGGCCACAGAATGGGTTAAGGGAAAAACGGTTGATTT
Full Trace Sequence: CTTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGGTGTGAGTCGGGTGTTTTGCTCGTTATGGAGAAGATGCGGGGTGCAGGAGCTTCGGGTGCCTTGCGCTTCTTATCATAAGAAGGTAGTTGATCATTATGAAAATCCAAGAAATGTTGGATCCCTTGACAAGAATGCAAAGAATGTTGGGACAGGTTTGGTGGGCGCACCAGCATGCGGTGATGTCATGAAACTACAGATTGAAGTGGATGACAATGGAAAAATTATTGAAGCCAAGTTCAAAACGTTTGGTTGTGGGTCTGCCATTGCCTCCAGTTCTCTGGCCACAGAATGGGTTAAGGGAAAAACGGTTGATTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCAAAAAACAAAATCCAAAAAGTTACAAAAAAAAGGCACCTCGGCAGCCCCACAAAAAAAAAAAGACAAATTAAAAAACACACATTTTTGTGTGGGGTTTCTTTTTGGGAAAAAAAAAAAGAGAAAAAAAAATCAAGAGGAGCGGTGGGTGTTTGGGGTGAAGGGACGGGGGGGGGGAGCCCCCCCACGCCGCCAACCCCCCCCGAACAACCCGGGGGGGGGTGGGGGCGCGGGGGGTTTGTTTGTGTTTGTTATTTTTATTTTTTCTTGGTATCCACTTTAGATCACCCAAAACCACAACAACAAAAAGACGGGGGGGGGGGGGGGGGGAGGGGTGGTTTTGGGAGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGGTGTGAGTCGGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ839456
dbEST ID: 79657158
Trimmed Sequence: ATCAACCGTTTTTCCCTTAACCCATTCTGTGGCCAGAGAACTGGAGGCAATGGCAGACCCACAACCAAACGTTTTGAACTTGGCTTCAATAATTTTTCCATTGTCATCCACTTCAATCTGTAGTTTCATGACATCACCGCATGCTGGTGCGCCCACCAAACCTGTCCCAACATTCTTTGCATTCTTGTCAAGGGATCCAACATTTCTTGGATTTTCATAATGATCAACTACCTTCTTATGATAAGAAGCGCAAGGCACCCGAAGCTCCTGCACCCCGCATCTTCTCCATAACGAGCAAAACACCCGACTCACACCAGCCATGG
Full Trace Sequence: AAACAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATCAACCGTTTTTCCCTTAACCCATTCTGTGGCCAGAGAACTGGAGGCAATGGCAGACCCACAACCAAACGTTTTGAACTTGGCTTCAATAATTTTTCCATTGTCATCCACTTCAATCTGTAGTTTCATGACATCACCGCATGCTGGTGCGCCCACCAAACCTGTCCCAACATTCTTTGCATTCTTGTCAAGGGATCCAACATTTCTTGGATTTTCATAATGATCAACTACCTTCTTATGATAAGAAGCGCAAGGCACCCGAAGCTCCTGCACCCCGCATCTTCTCCATAACGAGCAAAACACCCGACTCACACCAGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAAGACTGGCCGTCGTTTAACAACAAAAATGACTGAAAAACAAAAAGTAGCGCCCCTGGAACACACAAAAAAAAAAGAGGCCCCTCCAAACATCGCCGTTGTGTGGGTGGTGGGTTTCTCCGTAAAAGAAGCAACGCACAAAACACAATCGGGGTGTGTCTGTTTTGGTTTTGGTTTTTAGGAAAGAGAAGGGGTGGCCCCACAAACACGAGGGAAAACACCGGTGGAAGAAAGNGGGGGGGGGGGGGGGGGGGGGGGGGTGTGATTGGTGGGGTGGATATTNATTTTNNNTTTTTNNCAAGANNNGNNCNGCCAACGCGGACAGAGAAGAAAAAAGGGGGAACGNG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCAACCGTTTTTCCCTTAACCCA