ORFeome > isl1 ORF1 – XORFeome v1.0

isl1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: isl1
Gene ID: 865118
Gene Page ID: 481335
ORF Xenbase ID: 17280657

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124894
Original XGC clone length: 1065

Human orthology & disease relationships

NCBI Entrez ID: 3670
Ensembl gene IDs: ENSG00000016082
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: C03

Sequences - 5ʹ (forward) EST

Accession: JZ838775
dbEST ID: 79656477
Trimmed Sequence: ATGGGAGATATGGGAGACCCACCAAAAAAAAAGCGCCTGATTTCTCTGTGTGTTGGATGCGGGAATCAGATCCACGACCAATATATACTGAGGGTTTCCCCGGACTTGGAGTGGCACGCAGCTTGCCTCAAATGCGCAGAATGTAGCCAATACCTGGATGAGAGCTGCACTTGTTTTGTTAGGGATGGCAAAACCTACTGTAAAAGGGACTATATCAGGTTGTACGGGATCAAGTGCGCCAAGTGCAACATCGGCTTCAGCAAGAACGACTTCGTCATGAGGGCTCGCTCCAAGGTCTATCACATCGAGTGTTTCCGCTGCGTGGCGTGTAGTCGCCAACTGATCCCGGGGGACGATTTCGCGTTGAAGGAGGAGGGACTCATCTGTCGGGGAGACAACGACATGCTGGGGGGAACCGGTTTGGAAGGGAGCGAACCACTCAGTCGCCTGTCGCCCAGAAGGAGCCGATCTCATAAGAGCAGAATCACGTTTTTGGCCGGCAGGGGGGGGGGGCAGCTCACCTTTAAGAAGTAGGTGTGGAGGAAAGTAAGACGAGCAGGGAAGTGGTGGGTATAAAAAGAGGCTGGGACACAAGGGGTGAGTAGGGGGGGGACCGGTCGACCCCGGGAGGCGATGTGTGAAGGGGAGAGGTGGTAGAGAAGAGAGGTGGGGGGGGCGTAGAGGGGCGGGGGGTAAGGATGTGGGGTTGGGAGGCAAGAATGGGAGTTATTGAGGGAGAATATGCGTGTGTGCGAGGGGGGGAGCAAGGGGATAACGCTGCGTGCCGGATAGCAGCGAGGAAGTGTAATGGGATAAATAGTGAGGGGAGTAG
Full Trace Sequence: TCGCGGGCCATATAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGAGATATGGGAGACCCACCAAAAAAAAAGCGCCTGATTTCTCTGTGTGTTGGATGCGGGAATCAGATCCACGACCAATATATACTGAGGGTTTCCCCGGACTTGGAGTGGCACGCAGCTTGCCTCAAATGCGCAGAATGTAGCCAATACCTGGATGAGAGCTGCACTTGTTTTGTTAGGGATGGCAAAACCTACTGTAAAAGGGACTATATCAGGTTGTACGGGATCAAGTGCGCCAAGTGCAACATCGGCTTCAGCAAGAACGACTTCGTCATGAGGGCTCGCTCCAAGGTCTATCACATCGAGTGTTTCCGCTGCGTGGCGTGTAGTCGCCAACTGATCCCGGGGGACGATTTCGCGTTGAAGGAGGAGGGACTCATCTGTCGGGGAGACAACGACATGCTGGGGGGAACCGGTTTGGAAGGGAGCGAACCACTCAGTCGCCTGTCGCCCAGAAGGAGCCGATCTCATAAGAGCAGAATCACGTTTTTGGCCGGCAGGGGGGGGGGGCAGCTCACCTTTAAGAAGTAGGTGTGGAGGAAAGTAAGACGAGCAGGGAAGTGGTGGGTATAAAAAGAGGCTGGGACACAAGGGGTGAGTAGGGGGGGGACCGGTCGACCCCGGGAGGCGATGTGTGAAGGGGAGAGGTGGTAGAGAAGAGAGGTGGGGGGGGCGTAGAGGGGCGGGGGGTAAGGATGTGGGGTTGGGAGGCAAGAATGGGAGTTATTGAGGGAGAATATGCGTGTGTGCGAGGGGGGGAGCAAGGGGATAACGCTGCGTGCCGGATAGCAGCGAGGAAGTGTAATGGGATAAATAGTGAGGGGAGTAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAGATATGGGAGAC

Sequences - 3ʹ (reverse) EST

Accession: JZ838774
dbEST ID: 79656476
Trimmed Sequence: TGCCTCTATAGGGCTGGCTACCATGCTGTTTGGGGTATCTGGGAGCTGGGAGGACATGGAGGCCACCTCACTCCCTGTAGAGTTAGAGCCAGGTCCTCCTTCTGAAAAATTAACCTGTGAGAAACAGGTCAGTTGCTGGAAGGCCGGCTGATCAATGTCACTCTGTAGGGCAAAGTCACTGAGGACTTTCCAGGGGGGCTGATAAGTCTGCACTTCCACCGGGTTCGCCTGTAACCCACCGTCGTGTCTTTCGGGACTGGAGGCCACCATAGGGGTCCCTGTCATCCCTTGTATATTGGTTTTGTCGTTAGGTTGCTGTTGCTGTAGCTGCTTTATCAGGATGCTTCTCTTTTTGTCCTTGCACCTCTTGTTCTGAAACCAGACCCTGATGACCCTGGGACTGAGTCCAGTCATTTCCACGAGCTGTTCCTTCATCAGGGCATCAGGCCTGGGGTTGGCAGCGTAGCANGTCCTCAAGGTGTGAAGTTGCTTCTCATTAAAAACCGTCCTGACCCTGGTGGTCTTCTCTGGCTGCTTGTGCACGTGGGGTCGGAGCGCCGGCTGCCGGGCACAAATGGGTTCTGCTGCCATCTGTAAAGGTCTTCCTGGGTGAACGGGGAATGAGAAGGTCGCTGCCCCCCCTCCCTGCCCTTTCACCCACGTCCTGCTTCTGCCGGACGGAAGAATCCATCCCTCCCTCACCCCCAACCTCCTCCCCCCCGCATCATTTTTGCCGACAAACCCGCCCCCCGCCAGCCGCAAAAC
Full Trace Sequence: AAACGGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGCCTCTATAGGGCTGGCTACCATGCTGTTTGGGGTATCTGGGAGCTGGGAGGACATGGAGGCCACCTCACTCCCTGTAGAGTTAGAGCCAGGTCCTCCTTCTGAAAAATTAACCTGTGAGAAACAGGTCAGTTGCTGGAAGGCCGGCTGATCAATGTCACTCTGTAGGGCAAAGTCACTGAGGACTTTCCAGGGGGGCTGATAAGTCTGCACTTCCACCGGGTTCGCCTGTAACCCACCGTCGTGTCTTTCGGGACTGGAGGCCACCATAGGGGTCCCTGTCATCCCTTGTATATTGGTTTTGTCGTTAGGTTGCTGTTGCTGTAGCTGCTTTATCAGGATGCTTCTCTTTTTGTCCTTGCACCTCTTGTTCTGAAACCAGACCCTGATGACCCTGGGACTGAGTCCAGTCATTTCCACGAGCTGTTCCTTCATCAGGGCATCAGGCCTGGGGTTGGCAGCGTAGCANGTCCTCAAGGTGTGAAGTTGCTTCTCATTAAAAACCGTCCTGACCCTGGTGGTCTTCTCTGGCTGCTTGTGCACGTGGGGTCGGAGCGCCGGCTGCCGGGCACAAATGGGTTCTGCTGCCATCTGTAAAGGTCTTCCTGGGTGAACGGGGAATGAGAAGGTCGCTGCCCCCCCTCCCTGCCCTTTCACCCACGTCCTGCTTCTGCCGGACGGAAGAATCCATCCCTCCCTCACCCCCAACCTCCTCCCCCCCGCATCATTTTTGCCGACAAACCCGCCCCCCGCCAGCCGCAAAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCCTCTATAGGGCTGGCTAC