ORFeome > isyna1 ORF1 – XORFeome v1.0

isyna1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: isyna1
Gene ID: 969423
Gene Page ID: 969418
ORF Xenbase ID: 17280681

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044073
Original XGC clone length: 1692

Human orthology & disease relationships

NCBI Entrez ID: 51477
Ensembl gene IDs: ENSG00000105655
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 125851,235700,602485

Library Location

Plate ID: GDExl11007
Well Location: D10

Sequences - 5ʹ (forward) EST

Accession: JZ823616
dbEST ID: 79641318
Trimmed Sequence: ATGGCTGAGAAGTTCAAGGTGGAAAGCCCACATGTGCGATATTTAAAGGATGTAATAGAAGCCGATTACAACTATGACACCACACAAGTCTATGAGGAGAAAGGTGTTACCAAGGTCAAACCTTGTTCCACCAAGTTTACTTTCCACACAGAGCGAAAAGTTCCCAAACTTGGTGTCATGCTGGTTGGCTGGGGTGGAAATAATGGAACCACTGTCACTGCAGCTGTATTAGCAAATCGTCTGGGGCTTTCATGGATGACCAAAACAGGAAAAAAGGTTGCAAATTACTATGGTTCACTCTTCCAGTCATCCACTGCCTGTCTGGGCAGTGGTCCTGCTGGGGACGTTTTTGTCCCTTTCAGAGACCTTCTCCCCATGGTTCATCCCAATGATATAGTCTTCGATGGTTGGGATATCTCATCCTTGAACTTGGCTGATGCCATGTTTAGGGCAGAGGTTTTAGACTGGCAGATTCAGGAACAGTTGAGACCATATATGGAGAAGATGAAGCCACGGCCGTCGATCTATATCCCAGATTTTATTGCAGCCAATCAGGAAGACAGAGCCGACCACACGATCCATGGAACAAAAGCCGAACAGGTGCAGAAAATTCGGGAAGATATACAGGACTTTAAGAGAACCAGTGACGTAGACNAAGTTATTGTATTATGGACAGCAAACACTGAACGTTTCTGTGACATCATACCTGGGGTGAATGATACAGCTGATAATCTACTTAAAGCTATTGAGAATGGTCTTGAAGTGTCTCCATC
Full Trace Sequence: AAATATTGATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGAGAAGTTCAAGGTGGAAAGCCCACATGTGCGATATTTAAAGGATGTAATAGAAGCCGATTACAACTATGACACCACACAAGTCTATGAGGAGAAAGGTGTTACCAAGGTCAAACCTTGTTCCACCAAGTTTACTTTCCACACAGAGCGAAAAGTTCCCAAACTTGGTGTCATGCTGGTTGGCTGGGGTGGAAATAATGGAACCACTGTCACTGCAGCTGTATTAGCAAATCGTCTGGGGCTTTCATGGATGACCAAAACAGGAAAAAAGGTTGCAAATTACTATGGTTCACTCTTCCAGTCATCCACTGCCTGTCTGGGCAGTGGTCCTGCTGGGGACGTTTTTGTCCCTTTCAGAGACCTTCTCCCCATGGTTCATCCCAATGATATAGTCTTCGATGGTTGGGATATCTCATCCTTGAACTTGGCTGATGCCATGTTTAGGGCAGAGGTTTTAGACTGGCAGATTCAGGAACAGTTGAGACCATATATGGAGAAGATGAAGCCACGGCCGTCGATCTATATCCCAGATTTTATTGCAGCCAATCAGGAAGACAGAGCCGACCACACGATCCATGGAACAAAAGCCGAACAGGTGCAGAAAATTCGGGAAGATATACAGGACTTTAAGAGAACCAGTGACGTAGACNAAGTTATTGTATTATGGACAGCAAACACTGAACGTTTCTGTGACATCATACCTGGGGTGAATGATACAGCTGATAATCTACTTAAAGCTATTGAGAATGGTCTTGAAGTGTCTCCATC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGAGAAGTTCAAGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ828915
dbEST ID: 79646617
Trimmed Sequence: ATTCTCAATCTCAATGTCGCTGTTGATCACATTCTTCCCCAGTCCATTGGATTGGCTGAGGCCTTTGCTGATGCCAGGAAGATGGAAACCATTGGCATTATTCCCCTTTTTACTGGAAATAGGTTGAGGATTACAAACTGTGCTTGGCCTCTTGAGGCTGACAAAGCTTCTTTGCATCTTGTGCTCCAGCATCATGTGGTTTTGAGGAGAAAGACCCAAGCAAGCCCTTAGGATATTCTCAATGCAGTTCCTCTGCCTGAAAAAAGCATTGATTACTGGGGTCCCTGCAGGAACAAGAGGAGCCTTGCACAGGAAGCTCAGTATGGAAAGCACACTGTGGAATGTCTGGAATTCTTGGTCCGTCTCAGTGCGGAAGGTAATTCTTTGACAGAGCTCAGTAAGAAGCACTAAGTCCAGGATTATTGGGCTAGCAAGCAAGGAGTCCTCACATGTATTATGCAGAACAATGGTGTTGGCTCCCCCCATCATTATTTCTGATGTGTACTCATCCATTGCCCTTTTACTGTCTCCCACATAGGGGACATATTTGATCACCACACAGTGGTCTGGTTTCTCATTAGGCCCATACAGAATAGGGTTAGACTGCACCATGTCATCCACCACGTTGCTTTTTGATATTTCTTTTGAGCGAAACTGTTGGGGTGCTGAAAAGATTTTTCCCATCAT
Full Trace Sequence: CCGGCAGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTCTCAATCTCAATGTCGCTGTTGATCACATTCTTCCCCAGTCCATTGGATTGGCTGAGGCCTTTGCTGATGCCAGGAAGATGGAAACCATTGGCATTATTCCCCTTTTTACTGGAAATAGGTTGAGGATTACAAACTGTGCTTGGCCTCTTGAGGCTGACAAAGCTTCTTTGCATCTTGTGCTCCAGCATCATGTGGTTTTGAGGAGAAAGACCCAAGCAAGCCCTTAGGATATTCTCAATGCAGTTCCTCTGCCTGAAAAAAGCATTGATTACTGGGGTCCCTGCAGGAACAAGAGGAGCCTTGCACAGGAAGCTCAGTATGGAAAGCACACTGTGGAATGTCTGGAATTCTTGGTCCGTCTCAGTGCGGAAGGTAATTCTTTGACAGAGCTCAGTAAGAAGCACTAAGTCCAGGATTATTGGGCTAGCAAGCAAGGAGTCCTCACATGTATTATGCAGAACAATGGTGTTGGCTCCCCCCATCATTATTTCTGATGTGTACTCATCCATTGCCCTTTTACTGTCTCCCACATAGGGGACATATTTGATCACCACACAGTGGTCTGGTTTCTCATTAGGCCCATACAGAATAGGGTTAGACTGCACCATGTCATCCACCACGTTGCTTTTTGATATTTCTTTTGAGCGAAACTGTTGGGGTGCTGAAAAGATTTTTCCCATCAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTCTCAATCTCAATGTCGCTGT