ORFeome > itpa ORF1 – XORFeome v1.0

itpa ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: itpa
Gene ID: 1001458
Gene Page ID: 1001453
ORF Xenbase ID: 17280795

ORF full-length analysis tests

Full-Length confidence: medium
Original XGC clone accession: BC110771
Original XGC clone length: 588

Human orthology & disease relationships

NCBI Entrez ID: 3704
Ensembl gene IDs: ENSG00000125877
Directly associated (OMIM) disease MIM numbers: 613850
Indirectly associated (Lage, et al.) disease MIM numbers: 223100,236250,250940,266120,307030,603903,605899,609560

Library Location

Plate ID: GDExl11064
Well Location: F02

Sequences - 5ʹ (forward) EST

Accession: JZ833787
dbEST ID: 79651489
Trimmed Sequence: ATGGCAGCTGCAGCCGGCAGGAGTATAGTCTTTGTAACCGGGAACGCTAAAAAGCTGGAAGAGGTTGTTCAGATTCTTGGAGACAAATTTCCATGCAAATTAGTAGCCAAGAAAATTGACCTGCCAGAGTATCAAGGAGAACCAGATGAGATTTCCATTCAGAAATGTAGAGAGGCAGCAAAACAGATTCAAGGCCCAGTTATTGTAGAGGATACTTGCTTGTGTTTTAATGCATTGGGAGGTCTTCCTGGACCCTATATAAAATGGTTTCTTGAGAAGATCAAGCCAGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCAGCCATTGCCCTATGCACGTTTGCTTATTGCAATGGAAATCCTGATGATACAGTTCTTCTATTTAGAGGCAAAACCTTGGGACAAATTGTACTTCCCAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCGGATGGGTTTCAACAAACTTATGCTGAGCTCCCTAAAGAAGTGAAGAATACAATCTCCCACCGGTATCGTGCTTTAAAAGAAATGTCGGACTACTTCATCCAGAATGGCACGAAGGTTTT
Full Trace Sequence: CGGGTCATAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGCTGCAGCCGGCAGGAGTATAGTCTTTGTAACCGGGAACGCTAAAAAGCTGGAAGAGGTTGTTCAGATTCTTGGAGACAAATTTCCATGCAAATTAGTAGCCAAGAAAATTGACCTGCCAGAGTATCAAGGAGAACCAGATGAGATTTCCATTCAGAAATGTAGAGAGGCAGCAAAACAGATTCAAGGCCCAGTTATTGTAGAGGATACTTGCTTGTGTTTTAATGCATTGGGAGGTCTTCCTGGACCCTATATAAAATGGTTTCTTGAGAAGATCAAGCCAGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCAGCCATTGCCCTATGCACGTTTGCTTATTGCAATGGAAATCCTGATGATACAGTTCTTCTATTTAGAGGCAAAACCTTGGGACAAATTGTACTTCCCAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCGGATGGGTTTCAACAAACTTATGCTGAGCTCCCTAAAGAAGTGAAGAATACAATCTCCCACCGGTATCGTGCTTTAAAAGAAATGTCGGACTACTTCATCCAGAATGGCACGAAGGTTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGCTGCAGCCGGCA

Sequences - 3ʹ (reverse) EST

Accession: JZ833788
dbEST ID: 79651490
Trimmed Sequence: AACCTTCGTGCCATTCTGGATGAAGTAGTCCGACATTTCTTTTAAAGCACGATACCGGTGGGAGATTGTATTCTTCACTTCTTTAGGGAGCTCAGCATAAGTTTGTTGAAACCCATCCGGCTGGAAACAAGGATCCCATCCAAAGTCCCTTGGGCCTCTGGGAAGTACAATTTGTCCCAAGGTTTTGCCTCTAAATAGAAGAACTGTATCATCAGGATTTCCATTGCAATAAGCAAACGTGCATAGGGCAATGGCTGACTTGTCCTCAAATCCTTCTAACATTCGGTGCAGCCCTTCTGGCTTGATCTTCTCAAGAAACCATTTTATATAGGGTCCAGGAAGACCTCCCAATGCATTAAAACACAAGCAAGTATCCTCTACAATAACTGGGCCTTGAATCTGTTTTGCTGCCTCTCTACATTTCTGAATGGAAATCTCATCTGGTTCTCCTTGATACTCTGGCAGGTCAATTTTCTTGGCTACTAATTTGCATGGAAATTTGTCTCCAAGAATCTGAACAACCTCTTCCAGCTTTTTAGCGTTCCCGGTTACAAAGACTATACTCCTGCCGGCTGCAGCTGCCATGG
Full Trace Sequence: AGGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAACCTTCGTGCCATTCTGGATGAAGTAGTCCGACATTTCTTTTAAAGCACGATACCGGTGGGAGATTGTATTCTTCACTTCTTTAGGGAGCTCAGCATAAGTTTGTTGAAACCCATCCGGCTGGAAACAAGGATCCCATCCAAAGTCCCTTGGGCCTCTGGGAAGTACAATTTGTCCCAAGGTTTTGCCTCTAAATAGAAGAACTGTATCATCAGGATTTCCATTGCAATAAGCAAACGTGCATAGGGCAATGGCTGACTTGTCCTCAAATCCTTCTAACATTCGGTGCAGCCCTTCTGGCTTGATCTTCTCAAGAAACCATTTTATATAGGGTCCAGGAAGACCTCCCAATGCATTAAAACACAAGCAAGTATCCTCTACAATAACTGGGCCTTGAATCTGTTTTGCTGCCTCTCTACATTTCTGAATGGAAATCTCATCTGGTTCTCCTTGATACTCTGGCAGGTCAATTTTCTTGGCTACTAATTTGCATGGAAATTTGTCTCCAAGAATCTGAACAACCTCTTCCAGCTTTTTAGCGTTCCCGGTTACAAAGACTATACTCCTGCCGGCTGCAGCTGCCATGGTGCCAACTTTTTTGTAAAAAGTTGGCATTATAAAAAACCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAAACATTATTTTGGGGCCCGAACTAAAAAATGGGCCGTCCTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAACCTTCGTGCCATTCTGGAT