ORFeome > iyd ORF1 – XORFeome v1.0

iyd ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: iyd
Gene ID: 975250
Gene Page ID: 975244
ORF Xenbase ID: 17280825

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078565
Original XGC clone length: 885

Human orthology & disease relationships

NCBI Entrez ID: 389434
Ensembl gene IDs: ENSG00000009765
Directly associated (OMIM) disease MIM numbers: 274800
Indirectly associated (Lage, et al.) disease MIM numbers: 146300,214150,222900,241500,241510,601675

Library Location

Plate ID: GDExl11004
Well Location: A04

Sequences - 5ʹ (forward) EST

Accession: JZ839620
dbEST ID: 79657322
Trimmed Sequence: ATGGCAGCATTTTCCTTGTTAACGCCTGTGTTTATAGGCATTTTATGTGTCTTTATTGTGGTGATCCTAAGGAGTAGGGGAAAATCCTCCAACAAATTACAAGAGACTAAGAAGAAAAATAAAGAATCTAAACCATGGGTAGATGAGGATCTACAAGATGGGACTGAAATTCTGCTCAACGATGGTGAAGATAAGGAAGAGTGGCAAGACCTAGAGGAAGAAGATTTGTTGCACGTTCCATTTGCCCCTGCCCATTACCCAGTGGATGAAATGGTTAAAAGATCAAAACATTTTTATGAGTTGCTCAATCAAAGAAGATCAGTCAGGTTTATTAGCAATGAACCTGTTCCAAGAGAGGTTATTGAAAACATCATCAGAACAGCAGGGACATCTCCCAGTGGAGCCCATACTGAACCCTGGACATTTGTTGTTGTGCAAGACCCAGAAGTAAAACACAAAGTTAGGGAGATTATTGAGGAGGAAGAAGAAATCAACTACCACAAAAGAATGGGAGACAAGTGGGTTAGTGACCTAAAGAAACTAAGGACTAATTGGGTAAAAGAATATCTGGACACAGCTCCATTCCTTATCTTAATTTTCAAGCAAGTTTACGGGCAGCTTCCAAACAACAAAAAGAGAACTCATTATTATAATGAAATCAGTGTGTCTATTGCATGCGGTCTCCTGCTAGCAGCCATACAGAATGTCCGCTTGGTAACAGTGACCACTACACCTCTTAACTGTGGCCCTCCGTCTGCGTTTAATACCTCCGCCTTCCCGGTAAATGAAAAATTTGCTGAAACCTGCCTTCCCGTTAGGCT
Full Trace Sequence: GGGGGCCCATATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGCATTTTCCTTGTTAACGCCTGTGTTTATAGGCATTTTATGTGTCTTTATTGTGGTGATCCTAAGGAGTAGGGGAAAATCCTCCAACAAATTACAAGAGACTAAGAAGAAAAATAAAGAATCTAAACCATGGGTAGATGAGGATCTACAAGATGGGACTGAAATTCTGCTCAACGATGGTGAAGATAAGGAAGAGTGGCAAGACCTAGAGGAAGAAGATTTGTTGCACGTTCCATTTGCCCCTGCCCATTACCCAGTGGATGAAATGGTTAAAAGATCAAAACATTTTTATGAGTTGCTCAATCAAAGAAGATCAGTCAGGTTTATTAGCAATGAACCTGTTCCAAGAGAGGTTATTGAAAACATCATCAGAACAGCAGGGACATCTCCCAGTGGAGCCCATACTGAACCCTGGACATTTGTTGTTGTGCAAGACCCAGAAGTAAAACACAAAGTTAGGGAGATTATTGAGGAGGAAGAAGAAATCAACTACCACAAAAGAATGGGAGACAAGTGGGTTAGTGACCTAAAGAAACTAAGGACTAATTGGGTAAAAGAATATCTGGACACAGCTCCATTCCTTATCTTAATTTTCAAGCAAGTTTACGGGCAGCTTCCAAACAACAAAAAGAGAACTCATTATTATAATGAAATCAGTGTGTCTATTGCATGCGGTCTCCTGCTAGCAGCCATACAGAATGTCCGCTTGGTAACAGTGACCACTACACCTCTTAACTGTGGCCCTCCGTCTGCGTTTAATACCTCCGCCTTCCCGGTAAATGAAAAATTTGCTGAAACCTGCCTTCCCGTTAGGCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGCATTTTCCTTGTTAACG

Sequences - 3ʹ (reverse) EST

Accession: JZ839619
dbEST ID: 79657321
Trimmed Sequence: AACAATCACCATGATGTCTTGTAGTGGCTTCCTCTTCAGGTCTGGCACAGTGGCATCCTTACTGGGGTAGCCTACAGGAAGCAGCATCAGCAATTTCTCATTTACAGGACGCTGGAGTAATACACGCAGACGAGGGCCACAGTTCAGAGGTGTAGTGGTCACTGTTACCAAGCCGACATTCTGTATGGCTGCTAGCAGGAGACCGCATGCAATAGACACACTGATTTCATTATAATAATGAGTTCTCTTTTTGTTGTTTGGAAGCTGCCCGTAAACTTGCTTGAAAATTAAGATAAGGAATGGAGCTGTGTCCAGATATTCTTTTACCCAATTAGTCCTTAGTTTCTTTAGGTCACTAACCCACTTGTCTCCCATTCTTTTGTGGTAGTTGATTTCTTCTTCCTCCTCAATAATCTCCCTAACTTTGTGTTTTACTTCTGGGTCTTGCACAACAACAAATGTCCAGGGTTCAGTATGGGCTCCACTGGGAGATGTCCCTGCTGTTCTGATGATGTTTTCAATAACCTCTCTTGGAACAAGTTCATTGCTAATAAACCTGACTGATCTTCTTTGATTGAGCAACTCAAAAAAATGGTTTGATCTTTTAACCATTCATCCCACGGGGAATGGGCCGGGGCAAGTGGAAACTGGCACAAATCTTCCTTCCCTAGGTCTTTGCCACTCTCCCCTATCCTTCCCATCCTTTAACCAAAAGTTCAAGTCCCTTCTTTTTACAATCTCCTTCTAACCCATGGGGTTAAAAATCTTTTATTTTT
Full Trace Sequence: AAAAGGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAACAATCACCATGATGTCTTGTAGTGGCTTCCTCTTCAGGTCTGGCACAGTGGCATCCTTACTGGGGTAGCCTACAGGAAGCAGCATCAGCAATTTCTCATTTACAGGACGCTGGAGTAATACACGCAGACGAGGGCCACAGTTCAGAGGTGTAGTGGTCACTGTTACCAAGCCGACATTCTGTATGGCTGCTAGCAGGAGACCGCATGCAATAGACACACTGATTTCATTATAATAATGAGTTCTCTTTTTGTTGTTTGGAAGCTGCCCGTAAACTTGCTTGAAAATTAAGATAAGGAATGGAGCTGTGTCCAGATATTCTTTTACCCAATTAGTCCTTAGTTTCTTTAGGTCACTAACCCACTTGTCTCCCATTCTTTTGTGGTAGTTGATTTCTTCTTCCTCCTCAATAATCTCCCTAACTTTGTGTTTTACTTCTGGGTCTTGCACAACAACAAATGTCCAGGGTTCAGTATGGGCTCCACTGGGAGATGTCCCTGCTGTTCTGATGATGTTTTCAATAACCTCTCTTGGAACAAGTTCATTGCTAATAAACCTGACTGATCTTCTTTGATTGAGCAACTCAAAAAAATGGTTTGATCTTTTAACCATTCATCCCACGGGGAATGGGCCGGGGCAAGTGGAAACTGGCACAAATCTTCCTTCCCTAGGTCTTTGCCACTCTCCCCTATCCTTCCCATCCTTTAACCAAAAGTTCAAGTCCCTTCTTTTTACAATCTCCTTCTAACCCATGGGGTTAAAAATCTTTTATTTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAACAATCACCATGATGTCTTGTAG