ORFeome > jmjd6 ORF1 – XORFeome v1.0

jmjd6 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: jmjd6
Gene ID: 6078236
Gene Page ID: 966777
ORF Xenbase ID: 17280885

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC045252
Original XGC clone length: 1212

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11014
Well Location: H10

Sequences - 5ʹ (forward) EST

Accession: JZ824191
dbEST ID: 79641893
Trimmed Sequence: ATGAACCACAAGAGTAAGAAGCGCATCAAGGAGGCGAAACGCAGCGCCCGGCCCGAGCTCAAGGACTCGCAGGACTGGTGCCGCCATAATTACTGCGAGGTCTTCTCGTTAAACCCCAGTACTGTGCTGGATAATGTTGAGCGCGTCGACGCTGCACAACTCACCACAGAGGAGTTCATCGAACGCTATGAAAAACCCTACAAGCCGGTGGTTATCATTAACGCCACCGCTGGCTGGCCGGCCAATGAAAAATGGACCCTGGAACGGCTGAAGCGCAAGTATCGCAACCAGAAGTTCAAATGTGGGGAGGACAATGACGGTTACTCTGTGAAAATGAAAATGAAGTACTACATAGATTACATGGAGGGGACACGGGACGACAGCCCCCTGTACATCTTTGATAGCAGCTATGGTGAACACCCTAAGAGGAAGAAAATATTGGAGGATTACGAGGTGCCCAAATATTTCCGAGACGACCTGTTCCAGTTCACTGGGGAAAAACGACGTCCTCCATACAGGTGGTTTGTGATGGGACCGCCACGTTCTGGGACTGGAATTCATATTGACCCTTTGGGCACCAGTGCTTGGAACTCTCTAGTCCATGGGCATAAGCGCTGGTGCCTCTTTCCACTAACACACCGCGTGAACTGATCAAGTAACAGGGATGAAGGGGGGAATCAGCANGATGAGGCCATCACTTGGTTTCATGTTGTTTACCACGCACTCAGCTTTCATCATGGCCGCCTGAANTTTAACCTCTAGAGATCCTGCAGAACCCTGGGAAAAACGGTGTTTGGGTCCCCGGGAAGGGGTGGGG
Full Trace Sequence: CAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAACCACAAGAGTAAGAAGCGCATCAAGGAGGCGAAACGCAGCGCCCGGCCCGAGCTCAAGGACTCGCAGGACTGGTGCCGCCATAATTACTGCGAGGTCTTCTCGTTAAACCCCAGTACTGTGCTGGATAATGTTGAGCGCGTCGACGCTGCACAACTCACCACAGAGGAGTTCATCGAACGCTATGAAAAACCCTACAAGCCGGTGGTTATCATTAACGCCACCGCTGGCTGGCCGGCCAATGAAAAATGGACCCTGGAACGGCTGAAGCGCAAGTATCGCAACCAGAAGTTCAAATGTGGGGAGGACAATGACGGTTACTCTGTGAAAATGAAAATGAAGTACTACATAGATTACATGGAGGGGACACGGGACGACAGCCCCCTGTACATCTTTGATAGCAGCTATGGTGAACACCCTAAGAGGAAGAAAATATTGGAGGATTACGAGGTGCCCAAATATTTCCGAGACGACCTGTTCCAGTTCACTGGGGAAAAACGACGTCCTCCATACAGGTGGTTTGTGATGGGACCGCCACGTTCTGGGACTGGAATTCATATTGACCCTTTGGGCACCAGTGCTTGGAACTCTCTAGTCCATGGGCATAAGCGCTGGTGCCTCTTTCCACTAACACACCGCGTGAACTGATCAAGTAACAGGGATGAAGGGGGGAATCAGCANGATGAGGCCATCACTTGGTTTCATGTTGTTTACCACGCACTCAGCTTTCATCATGGCCGCCTGAANTTTAACCTCTAGAGATCCTGCAGAACCCTGGGAAAAACGGTGTTTGGGTCCCCGGGAAGGGGTGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACCACAAGAGTAAGAAGC

Sequences - 3ʹ (reverse) EST

Accession: JZ829496
dbEST ID: 79647198
Trimmed Sequence: CCTTGAAGAGCTACGCTCCTTGCTCGCGCAGTCATCCTGTGTAGTGATGTCACCATTCCCCATCCCGTTGCAGAGTCTCCTCTTCTTCTTCCTACGGGACATCATTTCCGCTCCAGAACTGGAGTCATCCTCTGAGCAGGACTCAGAAGAGCTGGAGGAAGAGGAACTGGAAGAATCGCTGGAAGAGTCCGATGCGATACCCGTGGATTCTTGAAGGTCCACAGTATCTGCCAGTGCTGCCAATTCTGGCCGTTCCTGCTTCAAAATCCTGTACCACTTCCTGGAAAGCTTGGGCCTCCCTCTCACAGTTTTGTGCCAAACTACAGGGAAATTAGAGCAGCTAGCGAAGTTCTGGGTAACCGCAATGGCGGTGTCGAAATTGAGGACCACATGCCACCAACCTCCCGGCACAAACACCGTCTCTCCAGGCTTCTGCAGGATCTCTAGAGGTTTAAATTCAGGCGGCCATGATGGAAGCTGAGTGCGTGGGTAAACAACATTGAACCAAGTGATGGCCTCATCCTGCTGATTCCCCCCCTCATCCCTTGTTACTTTGATCAGTTCACGCGGTGTGTTAGTGGGAAAGAGGCACCAGCGCTTATGCCCATGGACTAGAGAGTTCCAGCACGGGTGCCCCAAGGGTCAATATGAATTTCCGGTCCCAAAAAGGGCCCGTCCCCATCACAACCCCCCTGGTAGGGAGGAAACGTCTTTTTTTTCCCCCAGTGGAAAATTGGAAAC
Full Trace Sequence: GCAGCTGCCAGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCTTGAAGAGCTACGCTCCTTGCTCGCGCAGTCATCCTGTGTAGTGATGTCACCATTCCCCATCCCGTTGCAGAGTCTCCTCTTCTTCTTCCTACGGGACATCATTTCCGCTCCAGAACTGGAGTCATCCTCTGAGCAGGACTCAGAAGAGCTGGAGGAAGAGGAACTGGAAGAATCGCTGGAAGAGTCCGATGCGATACCCGTGGATTCTTGAAGGTCCACAGTATCTGCCAGTGCTGCCAATTCTGGCCGTTCCTGCTTCAAAATCCTGTACCACTTCCTGGAAAGCTTGGGCCTCCCTCTCACAGTTTTGTGCCAAACTACAGGGAAATTAGAGCAGCTAGCGAAGTTCTGGGTAACCGCAATGGCGGTGTCGAAATTGAGGACCACATGCCACCAACCTCCCGGCACAAACACCGTCTCTCCAGGCTTCTGCAGGATCTCTAGAGGTTTAAATTCAGGCGGCCATGATGGAAGCTGAGTGCGTGGGTAAACAACATTGAACCAAGTGATGGCCTCATCCTGCTGATTCCCCCCCTCATCCCTTGTTACTTTGATCAGTTCACGCGGTGTGTTAGTGGGAAAGAGGCACCAGCGCTTATGCCCATGGACTAGAGAGTTCCAGCACGGGTGCCCCAAGGGTCAATATGAATTTCCGGTCCCAAAAAGGGCCCGTCCCCATCACAACCCCCCTGGTAGGGAGGAAACGTCTTTTTTTTCCCCCAGTGGAAAATTGGAAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCTTGAAGAGCTACGCTCC