ORFeome > junb ORF2 – XORFeome v1.0

junb ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6256466
Gene Page ID:
ORF Xenbase ID: 17280921

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC125985
Original XGC clone length: 888

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: B03

Sequences - 5ʹ (forward) EST

Accession: JZ838120
dbEST ID: 79655822
Trimmed Sequence: ATGTGCTCCAAGATGGAGCAGCCTTTCTACCACGACGACTCCTTGTTGTCAGCCTACTCTCGGCCAGATGCTGGCCTCATGAAGCCCACCCTGGGGCACCTGTCCTACTATACCACCCAAGACTCCCCGGCGCTCGCCTCCCATCATACGACACCTTCCAGCCTGAAAATGGCTGCCCCAGAGCTTGAAAGAATGATCATTCACAGTGGCCCTGGGGTCATAACTGGTCCAAGCGGAGGGCAACTCTACTACTCCCGTGGCAATGGCATAACAGAGGAGCAAGAAGGCTTTGTGGATGGGTTCGTTAAGGCCCTTGATGACCTGCACAAGATGAACCGTGATTGTCCTCCCAATGTGTCGTTAGGTGGAGGCTCTATTCCTCTGGGTGGGAGCGCTGCCTCCCCTGCTGGTAGCAACATCTACGGGGACACTGCTGTTTACACCAACCTGGCCAATTACCACCCAAACATCTACCGCCAACCCTCTGCCACAATTAACTATTTACCACAGACTCATGGTGCCTATGGGGCTTCACCCTTTANAGAGGAGCCACAGACTGTCCCTGATACTGCTGGAGTAAGGGTGGACAGGCAGAGAAAGGTCTCCTGCACCAGTGTCTCCCATCAACATGTAGGAGCAGGAAAAAAATCAAGGTGGAGAGAAAGAGGCTAAAGGACCAATTGGCCCCCGCGAGTTCCCCCAAACCAAACCTGGGAAAGAATCTCCCGCCCTGGAAAAAAAAGTAAAAGAAACAAAAAAATGAAAACAACGGGCCTAAGTTGGGAAACCTTGGG
Full Trace Sequence: CGGGGGCCCATATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGCTCCAAGATGGAGCAGCCTTTCTACCACGACGACTCCTTGTTGTCAGCCTACTCTCGGCCAGATGCTGGCCTCATGAAGCCCACCCTGGGGCACCTGTCCTACTATACCACCCAAGACTCCCCGGCGCTCGCCTCCCATCATACGACACCTTCCAGCCTGAAAATGGCTGCCCCAGAGCTTGAAAGAATGATCATTCACAGTGGCCCTGGGGTCATAACTGGTCCAAGCGGAGGGCAACTCTACTACTCCCGTGGCAATGGCATAACAGAGGAGCAAGAAGGCTTTGTGGATGGGTTCGTTAAGGCCCTTGATGACCTGCACAAGATGAACCGTGATTGTCCTCCCAATGTGTCGTTAGGTGGAGGCTCTATTCCTCTGGGTGGGAGCGCTGCCTCCCCTGCTGGTAGCAACATCTACGGGGACACTGCTGTTTACACCAACCTGGCCAATTACCACCCAAACATCTACCGCCAACCCTCTGCCACAATTAACTATTTACCACAGACTCATGGTGCCTATGGGGCTTCACCCTTTANAGAGGAGCCACAGACTGTCCCTGATACTGCTGGAGTAAGGGTGGACAGGCAGAGAAAGGTCTCCTGCACCAGTGTCTCCCATCAACATGTAGGAGCAGGAAAAAAATCAAGGTGGAGAGAAAGAGGCTAAAGGACCAATTGGCCCCCGCGAGTTCCCCCAAACCAAACCTGGGAAAGAATCTCCCGCCCTGGAAAAAAAAGTAAAAGAAACAAAAAAATGAAAACAACGGGCCTAAGTTGGGAAACCTTGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGCTCCAAGATGGAGCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838119
dbEST ID: 79655821
Trimmed Sequence: GAAAACCTGATGCCCCTTCCCAGTTAGCAGAAGGTGGCAACCATGACGGGCATGTTCCCTCACCCTCACCTTCAGCTGCTCCACTTGCTCCCTAAGGGCCCCAGCTGTACCACTTAGGCCGTTGTTCTCATTCTTTAGATCCCTCACCTTTTCTTCCAGCCGGGAGATTCTCTCCAGCTTTCGTTTGCGGCACTTGGTGGCGGCCAATCGGTTCCTTAGCCTCTTTCTCTCCACCTTGATTTTCTCCTGCTCCTCCATGTTGATGGGAGACATTGGTGCAGGAGACCCTTCTCTGCTGTCCACCCTTACTCCAGCAGTATCAGGGACAGTCTGTGGCTCCTCTTTAAAGGGTGAAGCCCCATAGGCACCATGAGTCTGTGGTAAATAGTTAATTGTGGCAGAGGGTTGGCGGTAGATGTTTGGGTGGTAATTGGCCAGGTTGGTGTANACAGCAGTGTCCCCGTAGATGTTGCTACCAGCAGGGGAGGCAGCGCTCCCACCCAAAGGAAAAGAACCTCCCCCTAACGACACATTGGGAGGACAATCACGGTTCATCCTTGTGCGGTCATCAAGGGCCTTAACGAACCCATCCCCAAAGCCCTCTTGCTCCCCCGTTATGCCCTTGCACGGGCAGGAGTAAAGTTCCCCTCCCCTTGGAACAATTTAGAACCCCAACCCCGCTGTTGAATAATCATTCTGTTTCGGCCTCTTTGGCCCCCCAGTTTTTTAAGGTTGAAAAAGTGTCCGTGAAAAATGGGAAAGGGA
Full Trace Sequence: GGGGAAACAGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAAAACCTGATGCCCCTTCCCAGTTAGCAGAAGGTGGCAACCATGACGGGCATGTTCCCTCACCCTCACCTTCAGCTGCTCCACTTGCTCCCTAAGGGCCCCAGCTGTACCACTTAGGCCGTTGTTCTCATTCTTTAGATCCCTCACCTTTTCTTCCAGCCGGGAGATTCTCTCCAGCTTTCGTTTGCGGCACTTGGTGGCGGCCAATCGGTTCCTTAGCCTCTTTCTCTCCACCTTGATTTTCTCCTGCTCCTCCATGTTGATGGGAGACATTGGTGCAGGAGACCCTTCTCTGCTGTCCACCCTTACTCCAGCAGTATCAGGGACAGTCTGTGGCTCCTCTTTAAAGGGTGAAGCCCCATAGGCACCATGAGTCTGTGGTAAATAGTTAATTGTGGCAGAGGGTTGGCGGTAGATGTTTGGGTGGTAATTGGCCAGGTTGGTGTANACAGCAGTGTCCCCGTAGATGTTGCTACCAGCAGGGGAGGCAGCGCTCCCACCCAAAGGAAAAGAACCTCCCCCTAACGACACATTGGGAGGACAATCACGGTTCATCCTTGTGCGGTCATCAAGGGCCTTAACGAACCCATCCCCAAAGCCCTCTTGCTCCCCCGTTATGCCCTTGCACGGGCAGGAGTAAAGTTCCCCTCCCCTTGGAACAATTTAGAACCCCAACCCCGCTGTTGAATAATCATTCTGTTTCGGCCTCTTTGGCCCCCCAGTTTTTTAAGGTTGAAAAAGTGTCCGTGAAAAATGGGAAAGGGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAAACCTGATGCCCCTT