ORFeome > kalrn ORF1 – XORFeome v1.0

kalrn ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: kalrn
Gene ID: 1014011
Gene Page ID: 1014005
ORF Xenbase ID: 17280951

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124868
Original XGC clone length: 1989

Human orthology & disease relationships

NCBI Entrez ID: 8997
Ensembl gene IDs: ENSG00000160145
Directly associated (OMIM) disease MIM numbers: 608901
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: F01

Sequences - 5ʹ (forward) EST

Accession: JZ838135
dbEST ID: 79655837
Trimmed Sequence: ATGAAGAGTGGCACTAGCAAGTATCCCTCTGGCTCCTGCCTGGGATGGCTCTGTGCCCGGTGCTGCTGCTGTTTCTTTCCAACAGATTCATTTTCTGTCTCCACTGCGGAAAATGGAGCGAAATCAGAGTCCGTGGCGAATCTGCAGCCCCAGACCTCCTTGAATTCCATCCATAGTTCCCCAGGTCCCAAACGTTCCACCAACACCCTAAAAAAATGGCTGACGAGTCCTGTAAGGCGGCTGAACAGTGGGAAGGCAGACAGCAACATCAAGAAGCAAAAGAAAAGAGAAGGGCGGAACCTTGGTTCCCCCAGAGCTGGTGATGAGACCACCCCACAGGGTGACAGCGCAGATGAGAAGGGGAAGAAGGGATGGGACGAGGAGGCTGACGATGAATCCCACACACCGCTCCCTCCACCAATGAAGATCTTTGATAATGACCCCACTCCTGATGACAAGACAATTGATGGAGGGTCTTACCGTGGCCCACAGAACATAAATGAAGGCTATGTGAATGAGGGATTGGCCCCCTCGCCGGCTCCCACGAACCATGAAAAGGAGCAAAAAGCCAAAGCACTCAGGGGCAGGATGTTCGTATTGAATGAACTGGTGCAGACAAAGAAAGAATTATGTCAGGGATCTTGGGTTTTGTTGTAAATACGTACATTTCCCAAAATAAAAAAGAAAGAGAACCCCAATGATATGAACCGAAAAAAAAAGAATCAAAATTGGGAACATTTCCCCAAAACTTTTAATGGCAAAAGAAATTTTGTTATTGGAAAAAACTTAAAAAAAGGACTTCTCGAAACCCCAAA
Full Trace Sequence: GGCCCACAATAATAGATGTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGAGTGGCACTAGCAAGTATCCCTCTGGCTCCTGCCTGGGATGGCTCTGTGCCCGGTGCTGCTGCTGTTTCTTTCCAACAGATTCATTTTCTGTCTCCACTGCGGAAAATGGAGCGAAATCAGAGTCCGTGGCGAATCTGCAGCCCCAGACCTCCTTGAATTCCATCCATAGTTCCCCAGGTCCCAAACGTTCCACCAACACCCTAAAAAAATGGCTGACGAGTCCTGTAAGGCGGCTGAACAGTGGGAAGGCAGACAGCAACATCAAGAAGCAAAAGAAAAGAGAAGGGCGGAACCTTGGTTCCCCCAGAGCTGGTGATGAGACCACCCCACAGGGTGACAGCGCAGATGAGAAGGGGAAGAAGGGATGGGACGAGGAGGCTGACGATGAATCCCACACACCGCTCCCTCCACCAATGAAGATCTTTGATAATGACCCCACTCCTGATGACAAGACAATTGATGGAGGGTCTTACCGTGGCCCACAGAACATAAATGAAGGCTATGTGAATGAGGGATTGGCCCCCTCGCCGGCTCCCACGAACCATGAAAAGGAGCAAAAAGCCAAAGCACTCAGGGGCAGGATGTTCGTATTGAATGAACTGGTGCAGACAAAGAAAGAATTATGTCAGGGATCTTGGGTTTTGTTGTAAATACGTACATTTCCCAAAATAAAAAAGAAAGAGAACCCCAATGATATGAACCGAAAAAAAAAGAATCAAAATTGGGAACATTTCCCCAAAACTTTTAATGGCAAAAGAAATTTTGTTATTGGAAAAAACTTAAAAAAAGGACTTCTCGAAACCCCAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGAGTGGCACTAGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838134
dbEST ID: 79655836
Trimmed Sequence: CTTGATGGATCTGTCGCTATTTTCTAAGGAAGGTTTAGAAATATGGCCCAAGACTGATCCCGGAATCCAGCCTTCTGCTGCAGGGGAATGGTTGTTGGACGGTCGGAATACCAGGAACATGTTCTGCTGATTGATGGCTAGAATCTGTACAATCTCCCCATGGTACACGCAGATCTCATTTTCCTTTAGTGCATAGTAATCCTGGACAACCACCATGGAATTCGTCCCGTTACATCCACCCAGATCACTCTGGTTTGGCTCACATTTCTCCACACTCGGGTACAGTTCATACCCAGTGCTGCCGTTAGAGGTAGGTATTTTCCGTGCTGGTAGGGACTGGTTACGCATTGGGATGGCAACATCTTTTTCAGACCCTACATATGTGGAGGAGAGAGGCCTGATGGTGGGGGGATGGCCCGCGGCCTATTTGAGGCTTGTTCATGGCTGCGTTGCTCTCCTTCCGCTGGTATTCTATTGGGCATTGCAGGGCCTTGACAAAATCCCTCCTGATCTCCAGCACTTGNTTTATGTCCTGCGCCCAGGCCTGTTTTAATGCAAACAGCGAGTGCATACAGGAATACTCCGCTCTAATGTCTCTTGGCTCCTTATGGCAAACTGCCGGGGGGTCGTTACCAGTGGTTCTCCTCTAAGATAAACAAAATTAAATCGTTATGCCCTTTTTAGACCTTCTAACCCCAAACAATAAATAAACCGGTTCCGGGTGGAAACCTCCGTTTAAAAAAAGGGAAAATGTGGCTAAAAAAAGGAAAAAACCGCGC
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTGATGGATCTGTCGCTATTTTCTAAGGAAGGTTTAGAAATATGGCCCAAGACTGATCCCGGAATCCAGCCTTCTGCTGCAGGGGAATGGTTGTTGGACGGTCGGAATACCAGGAACATGTTCTGCTGATTGATGGCTAGAATCTGTACAATCTCCCCATGGTACACGCAGATCTCATTTTCCTTTAGTGCATAGTAATCCTGGACAACCACCATGGAATTCGTCCCGTTACATCCACCCAGATCACTCTGGTTTGGCTCACATTTCTCCACACTCGGGTACAGTTCATACCCAGTGCTGCCGTTAGAGGTAGGTATTTTCCGTGCTGGTAGGGACTGGTTACGCATTGGGATGGCAACATCTTTTTCAGACCCTACATATGTGGAGGAGAGAGGCCTGATGGTGGGGGGATGGCCCGCGGCCTATTTGAGGCTTGTTCATGGCTGCGTTGCTCTCCTTCCGCTGGTATTCTATTGGGCATTGCAGGGCCTTGACAAAATCCCTCCTGATCTCCAGCACTTGNTTTATGTCCTGCGCCCAGGCCTGTTTTAATGCAAACAGCGAGTGCATACAGGAATACTCCGCTCTAATGTCTCTTGGCTCCTTATGGCAAACTGCCGGGGGGTCGTTACCAGTGGTTCTCCTCTAAGATAAACAAAATTAAATCGTTATGCCCTTTTTAGACCTTCTAACCCCAAACAATAAATAAACCGGTTCCGGGTGGAAACCTCCGTTTAAAAAAAGGGAAAATGTGGCTAAAAAAAGGAAAAAACCGCGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTGATGGATCTGTCGCT