ORFeome > kars ORF1 – XORFeome v1.0

kars ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: kars
Gene ID: 943473
Gene Page ID: 943467
ORF Xenbase ID: 17280975

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC047965
Original XGC clone length: 1818

Human orthology & disease relationships

NCBI Entrez ID: 3735
Ensembl gene IDs: ENSG00000065427,LRG_366
Directly associated (OMIM) disease MIM numbers: 613641,613916
Indirectly associated (Lage, et al.) disease MIM numbers: 105400,125853,148700,151623,162210,193520,238700,275355,303600,607785

Library Location

Plate ID: GDExl11011
Well Location: G09

Sequences - 5ʹ (forward) EST

Accession: JZ823939
dbEST ID: 79641641
Trimmed Sequence: ATGTTGGTACCAGCACTGCTCAGGCTGGTTAGATGCCCAGTTTGGGCACAGAGAGTTCTAGAGGTGGATTTTCTTGGAAAACATCTGTCTACTTTCTGTGTTCTCTACAAGGACCAGGCATTTCATGGGAAAAAAAGTGAGCAAAAGAGGAGATTGAAAGCCGAAAAGAAAGCCACTGATAAGGAAGCCAAAAACAAAGAACAGAATGAGAAGCTGCTCACAGAAGAAGCCGCCGTTGATGAGGAAACCTTGGATCCTAATCAATATTTCAAGATTCGTACGCAGGCGATTCAGCAGCTGAAATGCACAAAGGATGACCCCTATCCTCACAAGTACCATGTTGATATGTCCCTTACAGAATTCATTGAGAAATACAACAATCTTCAGACTGGAGAGCAGTTATCAGAAATTGTCAGTGTAGCAGGTCGAATCCATGCCAAGCGTATTTCTGGAGCTAAACTGATTTTCTATGATTTGCGAGGTGAAGGAACAAAATTGCAAGTGATGGCCAATTCAAGATTTTACAAATCTGAGGAAGAATTTACAGCAATTAATAACAAGCTCCGTAGGGGCGATTTGATTGGAGTGAAAGGGAATCCTGGAAAACTAAAAAAGGTGAACTGAGTATCCTACCACATGAGATGACTCTGCTTTCTCCATGTCTCCATATGCTGCCACACCTCCCACTTCNGCTTTTGAAGACAGGAAACTAGATATCGACAGCGATACCTGGATCTTATCTTGAAATGATATGTGCGACAAAAATATCATTGTTTCTGGCCAAGCTTTTAACTAATCTTTCCGAAATCCCTTTGAAAATTTAGGCGTTCCCTGGGATT
Full Trace Sequence: CAATAATGATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTGGTACCAGCACTGCTCAGGCTGGTTAGATGCCCAGTTTGGGCACAGAGAGTTCTAGAGGTGGATTTTCTTGGAAAACATCTGTCTACTTTCTGTGTTCTCTACAAGGACCAGGCATTTCATGGGAAAAAAAGTGAGCAAAAGAGGAGATTGAAAGCCGAAAAGAAAGCCACTGATAAGGAAGCCAAAAACAAAGAACAGAATGAGAAGCTGCTCACAGAAGAAGCCGCCGTTGATGAGGAAACCTTGGATCCTAATCAATATTTCAAGATTCGTACGCAGGCGATTCAGCAGCTGAAATGCACAAAGGATGACCCCTATCCTCACAAGTACCATGTTGATATGTCCCTTACAGAATTCATTGAGAAATACAACAATCTTCAGACTGGAGAGCAGTTATCAGAAATTGTCAGTGTAGCAGGTCGAATCCATGCCAAGCGTATTTCTGGAGCTAAACTGATTTTCTATGATTTGCGAGGTGAAGGAACAAAATTGCAAGTGATGGCCAATTCAAGATTTTACAAATCTGAGGAAGAATTTACAGCAATTAATAACAAGCTCCGTAGGGGCGATTTGATTGGAGTGAAAGGGAATCCTGGAAAACTAAAAAAGGTGAACTGAGTATCCTACCACATGAGATGACTCTGCTTTCTCCATGTCTCCATATGCTGCCACACCTCCCACTTCNGCTTTTGAAGACAGGAAACTAGATATCGACAGCGATACCTGGATCTTATCTTGAAATGATATGTGCGACAAAAATATCATTGTTTCTGGCCAAGCTTTTAACTAATCTTTCCGAAATCCCTTTGAAAATTTAGGCGTTCCCTGGGATT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTGGTACCAGCACTGCTC

Sequences - 3ʹ (reverse) EST

Accession: JZ829248
dbEST ID: 79646950
Trimmed Sequence: CACAGACGTCCCATCAGAATTTGGGTTAGCATTAGGATCTTTCTTATTATCTTCAGGCTTCATGGCAGGGAAGAGTAAAACCTCCTTTATGTTATTGGAATCAGTAAGGAACATGGCCACTCGATCAATTCCCATTCCCCATCCAGCAGTTGGTGGAAGGCCATACTCTAGTGCAGTGCAGAAAGTCTCATCAATAAACATTGCCTCATCATCACCTGCTGCTTTGGCCTTAGCTTGATCCTCAAACAGCTCCCTTTGTCTGAATGGATCATTCAACTCTGTATAGGCGTTGCAGATCTCCTTTTTCATCACAAAAAGCTCAAACCTCTCTGTGAGTCCCTTTTCAGATCGGTGCCATTTTGCAAGAGGGCTCATAATTTGTGGATGGTCGCATATAAACGTTGGATTAATACAGGTCACCTCCAGGAAATCTCCAACCAGCTTGTCTAGCAGCCTGGCAGTGGTTCTCGGTGCTGGGCACTCAACCTCTTTTTCCACACAAATGTCATCAAGTAGTTTGCGGGTCTCTTCGGTTTCAAACTGATCTGTTGGAGGCAGTTTTTTCCCCAAGGCTTTTTCAAGCTCATGTACCATACTTAATTCTTCTGAAGGGGGGGAGTGAAGGTCAATCTCATAATTCTGGGGCCTTCTGGCCCTTTCAGGGTGGGTAGGGGTACTTTTGTAAACCACCAGGTATTATGTTTTTAACCCAATACCTGGAAAG
Full Trace Sequence: TGGCGAGTAGCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACAGACGTCCCATCAGAATTTGGGTTAGCATTAGGATCTTTCTTATTATCTTCAGGCTTCATGGCAGGGAAGAGTAAAACCTCCTTTATGTTATTGGAATCAGTAAGGAACATGGCCACTCGATCAATTCCCATTCCCCATCCAGCAGTTGGTGGAAGGCCATACTCTAGTGCAGTGCAGAAAGTCTCATCAATAAACATTGCCTCATCATCACCTGCTGCTTTGGCCTTAGCTTGATCCTCAAACAGCTCCCTTTGTCTGAATGGATCATTCAACTCTGTATAGGCGTTGCAGATCTCCTTTTTCATCACAAAAAGCTCAAACCTCTCTGTGAGTCCCTTTTCAGATCGGTGCCATTTTGCAAGAGGGCTCATAATTTGTGGATGGTCGCATATAAACGTTGGATTAATACAGGTCACCTCCAGGAAATCTCCAACCAGCTTGTCTAGCAGCCTGGCAGTGGTTCTCGGTGCTGGGCACTCAACCTCTTTTTCCACACAAATGTCATCAAGTAGTTTGCGGGTCTCTTCGGTTTCAAACTGATCTGTTGGAGGCAGTTTTTTCCCCAAGGCTTTTTCAAGCTCATGTACCATACTTAATTCTTCTGAAGGGGGGGAGTGAAGGTCAATCTCATAATTCTGGGGCCTTCTGGCCCTTTCAGGGTGGGTAGGGGTACTTTTGTAAACCACCAGGTATTATGTTTTTAACCCAATACCTGGAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACAGACGTCCCATCAGAA