ORFeome > kcnip4 ORF1 – XORFeome v1.0

kcnip4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: kcnip4
Gene ID: 5753459
Gene Page ID: 5753457
ORF Xenbase ID: 17281059

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097806
Original XGC clone length: 702

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: C01

Sequences - 5ʹ (forward) EST

Accession: JZ838427
dbEST ID: 79656129
Trimmed Sequence: ATGATCACAGTGGAGTGGGAGTCGGAGGGACTGCAGACAGTGGGGATCGTTATGATTATCTGTGCGTCTCTCAAGCTGCTGCATCTGTTGGGCTTGATCGACTTCTCCGAAGACAATGTGGAAGATGAAATGGAGACGGCAACTGTGCGTCATCGCCCGGAGGCACTTGAACTGCTGGAAGCACAGACCAAGTTTACAAAGAAGGAGCTTCAGATTCTGTACAGAGGTTTCAAAAACGAATGTCCCAGTGGAATTGTTAATGAAGAGACCTTTAAAGATATCTATGCCCAGTTCTTCCCACAAGGAGATGCATCCACATATGCACATTTTCTGTTTAACGCATTTGATACAGACCATGACGGATCTGTAAGTTTTGAGGATTTTGTAATCGGTCTGTCTACATTGCTTCGCGGCACAATTCAGGAAAAATTAAACTGGGCTTTTAATTTATATGATATAAATAAAGATGGATACATAACAAAAGAGGAGATGTTTGATATAATTAAATCCATTTATGACATGATGGGAAAATGTACATACCCTCTACTCACAGAGGAAACACCAAGGCAACGTGTGGAGAATTTCTTCCCTAACATGGATATTGATAACTATGGGAGTGCTTACTAGCCCACAATTCATAAATAACTGCCGGGCAGAATAAA
Full Trace Sequence: GGGCCCAAATAATAGATTTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATCACAGTGGAGTGGGAGTCGGAGGGACTGCAGACAGTGGGGATCGTTATGATTATCTGTGCGTCTCTCAAGCTGCTGCATCTGTTGGGCTTGATCGACTTCTCCGAAGACAATGTGGAAGATGAAATGGAGACGGCAACTGTGCGTCATCGCCCGGAGGCACTTGAACTGCTGGAAGCACAGACCAAGTTTACAAAGAAGGAGCTTCAGATTCTGTACAGAGGTTTCAAAAACGAATGTCCCAGTGGAATTGTTAATGAAGAGACCTTTAAAGATATCTATGCCCAGTTCTTCCCACAAGGAGATGCATCCACATATGCACATTTTCTGTTTAACGCATTTGATACAGACCATGACGGATCTGTAAGTTTTGAGGATTTTGTAATCGGTCTGTCTACATTGCTTCGCGGCACAATTCAGGAAAAATTAAACTGGGCTTTTAATTTATATGATATAAATAAAGATGGATACATAACAAAAGAGGAGATGTTTGATATAATTAAATCCATTTATGACATGATGGGAAAATGTACATACCCTCTACTCACAGAGGAAACACCAAGGCAACGTGTGGAGAATTTCTTCCCTAACATGGATATTGATAACTATGGGAGTGCTTACTAGCCCACAATTCATAAATAACTGCCGGGCAGAATAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATCACAGTGGAGTGG

Sequences - 3ʹ (reverse) EST

Accession: JZ838426
dbEST ID: 79656128
Trimmed Sequence: TATCACATTCTCAAACAGCTGCATAGAGCACATAATATTTTCATCTTTTTGGCAGCTCTCTATGAATTCTTCTATAGTAACCACTCCATCTTTATTAATATCCATTTTCTGGAAGAAATTCTCCACATGTTGCCTTGGTGTTTCCTCTCTGACTAGAGGGTATGTACATTTTCCCATCATGTCATAAATGGATTTAATTATATCAAACATCTCCTCTTTTGTTATGTATCCATCTTTATTTATATCATATAAATTAAAAGCCCAGTTTAATTTTTCCTGAATTGTGCCGCGAAGCAATGTAGACAGACCGATTACAAAATCCTCAAAACTTACAGATCCGTCATGGTCTGTATCAAATGCGTTAAACAGAAAATGTGCGTATGTGGATGCATCTCCTTGTGGGAAGAACTGGGCGTAGATATCTTTAAAGGTCTCTTCATTAACAATTCCACTGGGGACATTCGTTTTTGAAACCTCTGTACAGAATCTGAAGCTCCTTCTTTTTAAGCTTGTTCTGTGCTTCCAGCAGTTCAAGTGCCGCCGGGCGATGAGGCACATTTGCCGTCTCCCTTTCATCTTCCCCATTTGTCTTCGGAAAAGGCGATAAAACCCAACAAATGAAACGGCGTTTGGAGACGCCAAA
Full Trace Sequence: GGGGAATATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATATCACATTCTCAAACAGCTGCATAGAGCACATAATATTTTCATCTTTTTGGCAGCTCTCTATGAATTCTTCTATAGTAACCACTCCATCTTTATTAATATCCATTTTCTGGAAGAAATTCTCCACATGTTGCCTTGGTGTTTCCTCTCTGACTAGAGGGTATGTACATTTTCCCATCATGTCATAAATGGATTTAATTATATCAAACATCTCCTCTTTTGTTATGTATCCATCTTTATTTATATCATATAAATTAAAAGCCCAGTTTAATTTTTCCTGAATTGTGCCGCGAAGCAATGTAGACAGACCGATTACAAAATCCTCAAAACTTACAGATCCGTCATGGTCTGTATCAAATGCGTTAAACAGAAAATGTGCGTATGTGGATGCATCTCCTTGTGGGAAGAACTGGGCGTAGATATCTTTAAAGGTCTCTTCATTAACAATTCCACTGGGGACATTCGTTTTTGAAACCTCTGTACAGAATCTGAAGCTCCTTCTTTTTAAGCTTGTTCTGTGCTTCCAGCAGTTCAAGTGCCGCCGGGCGATGAGGCACATTTGCCGTCTCCCTTTCATCTTCCCCATTTGTCTTCGGAAAAGGCGATAAAACCCAACAAATGAAACGGCGTTTGGAGACGCCAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATATCACATTCTCAAACAGCTGCAT