ORFeome > kcnk6 ORF1 – XORFeome v1.0

kcnk6 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: kcnk6
Gene ID: 958684
Gene Page ID: 958680
ORF Xenbase ID: 17281101

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123205
Original XGC clone length: 927

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: E09

Sequences - 5ʹ (forward) EST

Accession: JZ838288
dbEST ID: 79655990
Trimmed Sequence: ATGAAATTCTGGCTGTTACTCACGCTACTTGTGTGTGTCTATGTGATCTACCTCCTGCTGGGGGCCTTGGTGATTTCAGTCATTGAGTCGCCATATGAGGCCAGCCTGCGAGATGAACTGAGACAACTCAAAAGTATCTTTCTCAATGAGAGCCCATGTGTTAATGTTAGTAGCCTGGAAGCCTTCTTGGAGAAAATAATCAATGCCAACAAGTATGGGGTGTCTGTCCTGCACAATGCTTCCAACGACAGCAAATGGGATATCGCATCTTCTCTGTTTTTTGCCAGTACTTTGGTGACCACTGTAGGTTATGGATACACCACTCCCTTAACAGACTCTGGCAAAGCATTCTGCATTTTCTATGCACTCATTGGTGTGCCATTTACTATGCTGGTGCTCAGCTCATTTGTCCAGCGCCTGATGGTCTTGTTTACCCACAAGCCAATACACTACTTGCAGGTGCACAGAGGTTTGGACCGAAAGATGGTCACTCAGTATCACTTCTTTCTCCTGTTACTTATAGTTTTGGTTTTCTTCCTCATCATTCCATCTGCAATTTTTAACACCATAGAAACTACATGGAGTTTCCTGGATGCTTTTTACTTCTGTTTTATTTCCCTATTCATCATTGGACTGGGGGAGTAAGTGGAGGGAGAACAAAAATGAAAAATTGCGTGCGAACCTCTAACAAGAGTCTGGGGGCGGCGGCCGTGGTTTTTGGCCCTTGTGGCGGGGCGCCGGGAGGTCGGGAGGTTTCCGGGAGCCTTCCTTATCTTTATGGGATCCCCGGGGAAACGTTTTTGAACTTTCCTCATCTTT
Full Trace Sequence: GGAGGGCCCATATAATAGATTTTATTTNTGACTGATAGTGACCTGNTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAATTCTGGCTGTTACTCACGCTACTTGTGTGTGTCTATGTGATCTACCTCCTGCTGGGGGCCTTGGTGATTTCAGTCATTGAGTCGCCATATGAGGCCAGCCTGCGAGATGAACTGAGACAACTCAAAAGTATCTTTCTCAATGAGAGCCCATGTGTTAATGTTAGTAGCCTGGAAGCCTTCTTGGAGAAAATAATCAATGCCAACAAGTATGGGGTGTCTGTCCTGCACAATGCTTCCAACGACAGCAAATGGGATATCGCATCTTCTCTGTTTTTTGCCAGTACTTTGGTGACCACTGTAGGTTATGGATACACCACTCCCTTAACAGACTCTGGCAAAGCATTCTGCATTTTCTATGCACTCATTGGTGTGCCATTTACTATGCTGGTGCTCAGCTCATTTGTCCAGCGCCTGATGGTCTTGTTTACCCACAAGCCAATACACTACTTGCAGGTGCACAGAGGTTTGGACCGAAAGATGGTCACTCAGTATCACTTCTTTCTCCTGTTACTTATAGTTTTGGTTTTCTTCCTCATCATTCCATCTGCAATTTTTAACACCATAGAAACTACATGGAGTTTCCTGGATGCTTTTTACTTCTGTTTTATTTCCCTATTCATCATTGGACTGGGGGAGTAAGTGGAGGGAGAACAAAAATGAAAAATTGCGTGCGAACCTCTAACAAGAGTCTGGGGGCGGCGGCCGTGGTTTTTGGCCCTTGTGGCGGGGCGCCGGGAGGTCGGGAGGTTTCCGGGAGCCTTCCTTATCTTTATGGGATCCCCGGGGAAACGTTTTTGAACTTTCCTCATCTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAATTCTGGCTGTTACTCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ838287
dbEST ID: 79655989
Trimmed Sequence: CCGATTGATAGATGAGTAGTCCGGTTGGGACTCTGTTGCAAGCCGTCTTTTTGGTTCCAAGTCTTTCGTTGAGTAGTCAGTGGTTTCCAGGATGGGTTCTTGGTCATCTTGATCTTGCAAACGAGGAAGGTAAAAGATGTCAGTGAGTCCATGAAGATCAGAAGCTTTGTGGAATGTCGGGACAATCAGCAGCATGGCCATGAGGCCAACAAACAGGTAGAAGGCCACAGACACCTTGTAGAGCTTCCGGAGCGACTGGTCATTCTGCTCGCCTGGGAGATAATCCCCCACTCCAATGGTGCATAGGGAAAGAATACAAAAGTAAAAAGCGGGCCGGGAGACTCCCTGTAGTTTCTATGGTGTTGGGAACTGCGGGGGGGAGGGTGAGGGGGAAAACCACACCTATCACTAACAGGAGAGGGAAAGGATGGTGAGGGAGCGGGTCTCGGTCCAGCCCACCCTGCGCGTGCGCCGGGGTGTAGTGTTTGGGGGGGGGCCGCACCACCCCCCCTGGGGAGGGGGCAGAGCAGGAACACACTAATGGGACTCCGGTGGCTGCTTATTACAGGGGGATGGGTTCCCGGGGGCGACAGGGAAGGGGGGGGGTGGGGAAGGAAGAGGAGGGAGGGGGGGCCCTCCGAGCAAGGGGGGGGAGGGGGGGAGGGTGGCTTTTCCTTGTTGGGGGGTGGGGGGGGGGGGGGGCGCACGGCACTGTGTGGCTTGGTTTTTTTTGTGTTTGTGAATTTTGGGGGGGGGGGGGGG
Full Trace Sequence: GGGAAAACGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCGATTGATAGATGAGTAGTCCGGTTGGGACTCTGTTGCAAGCCGTCTTTTTGGTTCCAAGTCTTTCGTTGAGTAGTCAGTGGTTTCCAGGATGGGTTCTTGGTCATCTTGATCTTGCAAACGAGGAAGGTAAAAGATGTCAGTGAGTCCATGAAGATCAGAAGCTTTGTGGAATGTCGGGACAATCAGCAGCATGGCCATGAGGCCAACAAACAGGTAGAAGGCCACAGACACCTTGTAGAGCTTCCGGAGCGACTGGTCATTCTGCTCGCCTGGGAGATAATCCCCCACTCCAATGGTGCATAGGGAAAGAATACAAAAGTAAAAAGCGGGCCGGGAGACTCCCTGTAGTTTCTATGGTGTTGGGAACTGCGGGGGGGAGGGTGAGGGGGAAAACCACACCTATCACTAACAGGAGAGGGAAAGGATGGTGAGGGAGCGGGTCTCGGTCCAGCCCACCCTGCGCGTGCGCCGGGGTGTAGTGTTTGGGGGGGGGCCGCACCACCCCCCCTGGGGAGGGGGCAGAGCAGGAACACACTAATGGGACTCCGGTGGCTGCTTATTACAGGGGGATGGGTTCCCGGGGGCGACAGGGAAGGGGGGGGGTGGGGAAGGAAGAGGAGGGAGGGGGGGCCCTCCGAGCAAGGGGGGGGAGGGGGGGAGGGTGGCTTTTCCTTGTTGGGGGGTGGGGGGGGGGGGGGGCGCACGGCACTGTGTGGCTTGGTTTTTTTTGTGTTTGTGAATTTTGGGGGGGGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCGATTGATAGATGAGTAGTCC