ORFeome > kctd9 ORF1 – XORFeome v1.0

kctd9 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: kctd9
Gene ID: 6078358
Gene Page ID: 976410
ORF Xenbase ID: 17281167

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC126039
Original XGC clone length: 1170

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: B05

Sequences - 5ʹ (forward) EST

Accession: JZ837491
dbEST ID: 79655193
Trimmed Sequence: ATGAGGCGGGTCACCCTGTTTGTGAGGGGAAGCCCGTTGCACGGAAAGGTGATTCCAGTCACTGGGTCGCTCTCAGACCTGCTCTCCCTGGCCAGCATCACATTTGGAATCCAAGCAACGCAAGTGTTCAATGAAAATGGAGGACAGATAGATGACATCTCTCTCATCCGAGATGATGATGTCCTCTACGTGGCTGAGGAGGAGTCAGAAGTTGACCCAATGGCCAGTTTTGAGATCCCTGAGCAACTAACAGGCGGTCATACAGACTGGTTAACCCTTAATGTGGGAGGTCGATATTTTACCACTACAAGGAGCACACTTGTCAGTAAGGAGCCAGACAGCATGCTGTCCCACATGTTCAGTGATGGAGATGCCTGGGGAAATAAAAGGGATCATACAGGTGCATTCCTGATTGACCGTAGCCCGGAATATTTTGAGCCGATCCTAAACTTCCTGCGTCACGGGCAGCTAATTGTCAATGATGGAGTCAACCTGCTGGGAGTACTGGAAGAGGCCAAGTTCTTTGGCATTGATTCTTTGATAGAACACTTAGAAGTGGCCATAAAGAATTCCCAACCTGCAGATGATCATTCTCCCATCTCCCGTAGAGAGTTTATTCGGTTCCTTTTAGCCACTCCCACCAAATCAGAATTGCGTTTGCAGGGTCTCAATTTCAGTGGTGCTGACCTCTCTCGCTTGGACCTAGGATATATAAACTTTAAGATGGCCAACCTAAAGTCGATGCCATCTGGGCTCATGCCAAAATCTATGTTGAATTCCTGCCTTTGGAAA
Full Trace Sequence: GGGGCCCCAATAATGGATTTTATTTTNGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGGCGGGTCACCCTGTTTGTGAGGGGAAGCCCGTTGCACGGAAAGGTGATTCCAGTCACTGGGTCGCTCTCAGACCTGCTCTCCCTGGCCAGCATCACATTTGGAATCCAAGCAACGCAAGTGTTCAATGAAAATGGAGGACAGATAGATGACATCTCTCTCATCCGAGATGATGATGTCCTCTACGTGGCTGAGGAGGAGTCAGAAGTTGACCCAATGGCCAGTTTTGAGATCCCTGAGCAACTAACAGGCGGTCATACAGACTGGTTAACCCTTAATGTGGGAGGTCGATATTTTACCACTACAAGGAGCACACTTGTCAGTAAGGAGCCAGACAGCATGCTGTCCCACATGTTCAGTGATGGAGATGCCTGGGGAAATAAAAGGGATCATACAGGTGCATTCCTGATTGACCGTAGCCCGGAATATTTTGAGCCGATCCTAAACTTCCTGCGTCACGGGCAGCTAATTGTCAATGATGGAGTCAACCTGCTGGGAGTACTGGAAGAGGCCAAGTTCTTTGGCATTGATTCTTTGATAGAACACTTAGAAGTGGCCATAAAGAATTCCCAACCTGCAGATGATCATTCTCCCATCTCCCGTAGAGAGTTTATTCGGTTCCTTTTAGCCACTCCCACCAAATCAGAATTGCGTTTGCAGGGTCTCAATTTCAGTGGTGCTGACCTCTCTCGCTTGGACCTAGGATATATAAACTTTAAGATGGCCAACCTAAAGTCGATGCCATCTGGGCTCATGCCAAAATCTATGTTGAATTCCTGCCTTTGGAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGGCGGGTCACCCTGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ837490
dbEST ID: 79655192
Trimmed Sequence: TCTGACACTCTGAGACATGTGCAATGGGGTCAGCATCTCTTCAAAGATGGCCCCTTTGACATTGGAGCCCCGGAGATTGGCTTCCTGCAGGTCACATCCCGAGAGGTCACAGTTCTCTAGGTCTGTTCCTGCCAGGGTAGCGCCCCGTAGGTTGCAGTTTTTCAGTTTGGCATTTTTAAGAGTTGCTACACGTAGGTTAATCCCAGTCATCTGACTGCCTTCCATGTCAACGCCCTTCAGATTAGCACCTTCTAAATTTGCTTTTAAGCCAGATGGGTCCTCAAAGTTACATCCTTTAAGAGACGCCCCTTCTGCATTGGAGCAGAGCATCTTCACACCCTGGAGATTGGCCCCATCCAGTACAGATCCAGAGAGGTCAGCCCTCTCCAAGCAGGATCCACATAGATTTGCATGAGCCAGATTGCATCGACTTAGGTTGGCCATCTTAAAGTTTATATATCTTAGGTCCAAGCGAGAGAGGTCAGCACCACTGAAATTGAGACCCTGGCAACGCAATTCTGATTTGGTGGGAGTGGCTAAGAGGAACCGAATAAACTCTTTACGGGAGATGGGAAAATGATCATCTGCCGGTTGGGAATTCTTTATGGCCACTTCTAAGTGTTCTATCAAAAAATCAATGGCAAAGAACTTTGGCCTCTTCCATTACTCCCACCAGGTTAACTCCATTCATTGACAATTTACCTGCCCGTGAACGCCAGGAAGTTTTAGAAACCGGGCCTCAAAATAATTCCCGGGGCCTAGGGGTCAATCC
Full Trace Sequence: GGGAAAATGTCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCTGACACTCTGAGACATGTGCAATGGGGTCAGCATCTCTTCAAAGATGGCCCCTTTGACATTGGAGCCCCGGAGATTGGCTTCCTGCAGGTCACATCCCGAGAGGTCACAGTTCTCTAGGTCTGTTCCTGCCAGGGTAGCGCCCCGTAGGTTGCAGTTTTTCAGTTTGGCATTTTTAAGAGTTGCTACACGTAGGTTAATCCCAGTCATCTGACTGCCTTCCATGTCAACGCCCTTCAGATTAGCACCTTCTAAATTTGCTTTTAAGCCAGATGGGTCCTCAAAGTTACATCCTTTAAGAGACGCCCCTTCTGCATTGGAGCAGAGCATCTTCACACCCTGGAGATTGGCCCCATCCAGTACAGATCCAGAGAGGTCAGCCCTCTCCAAGCAGGATCCACATAGATTTGCATGAGCCAGATTGCATCGACTTAGGTTGGCCATCTTAAAGTTTATATATCTTAGGTCCAAGCGAGAGAGGTCAGCACCACTGAAATTGAGACCCTGGCAACGCAATTCTGATTTGGTGGGAGTGGCTAAGAGGAACCGAATAAACTCTTTACGGGAGATGGGAAAATGATCATCTGCCGGTTGGGAATTCTTTATGGCCACTTCTAAGTGTTCTATCAAAAAATCAATGGCAAAGAACTTTGGCCTCTTCCATTACTCCCACCAGGTTAACTCCATTCATTGACAATTTACCTGCCCGTGAACGCCAGGAAGTTTTAGAAACCGGGCCTCAAAATAATTCCCGGGGCCTAGGGGTCAATCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCTGACACTCTGAGACATGTGCAA