ORFeome > kdelc2 ORF1 – XORFeome v1.0

kdelc2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: kdelc2
Gene ID: 1002533
Gene Page ID: 1002529
ORF Xenbase ID: 17281173

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC123307
Original XGC clone length: 1530

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: H11

Sequences - 5ʹ (forward) EST

Accession: JZ837564
dbEST ID: 79655266
Trimmed Sequence: 0
Full Trace Sequence: GGCGCCAGATAATAGATTTTATTTGTGATCGATACTGATATCGTTCATTGCGAGTCTTATATAGATGGTCGCATTTGTTTCCGGGCACCTTGGGCCCGTGTCTGGCATCTCGAAAGTGACAAGGCCTATTCCCGGGGCTGCCCTGATTTTATTACTGGCCTGGGCCTCGGCCGGAGCCGCTGCTGGAGGCGCAGAGACGTTGAGCGCGGAGAAGAGCCTGGTGTGGGGCCCGGGACTACACGCTGACATCGTCCTGCCGGTCCGCTACTTCTACATACAGGCTGTCACCGCCGGGGGGCGCAACTTCACCCAATCACCAGGAAAAGGGGCATTTAGGGTTGTCATCAGATCACTCGCGAAAGAGTTTGTGCGCATTCATGTACCTGATCCTCTAGACCGGAACGATGGCTCATTTCTGATGAGATACCGCATGTACGGCACTGGGAACCAGGGGCTGATGATCGAGGTGCTTCATGGAGACAAGCACGTTGCACAGTCCCCTTATACGCTAAAGGGTCCAGTCTATCATGAATACTGTGACTGCCCAGAAGAAGACCCTCAGACATGGCAGGAGACTCTGTCTTGCCCAGACACAGAAGCTCAGATTTCTAAAGACTTTGAACCTTTCCCAAGCATCGACCTCACCAGGCTTCTCAATGATGTTCCGAATAGATTTGCAGACAGAGGGGGGCAGTGTACACTATACCGTCCTCAGTAATCAAATCTAATCCCCGCTCCGTGGTCAGATGCACCGAACTTCCAGATGTTTTCCTGATAAAATAGTTTACATCATTTGCCAAAAAGGGGGCGATCGGCGGGACTTGGAAGTTCTATATTTAATTTTTGCGAGTGGGGCGGGGGGGAGGGTCCGGAGGN
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGACGGATAGGGCCTATT

Sequences - 3ʹ (reverse) EST

Accession: JZ837563
dbEST ID: 79655265
Trimmed Sequence: CAGTTCCTCCCTGATGATCTTCTTCCTGTGGCACTGGCACATGGCGGAACTATCATCTGGCTGAGGGACATGTTCCATCTTCTCCCGGATTTCAGGCTTGCTTGTTTGCCGCTTGGCATAGTTCTCAAACACTTTATAATAATAGCAGTACAGCCTGTGAGGTTGCATCAGCTCTCTGACAAGTGTCTGTCCTTCCTTGGCAATCTGTCTTGCTTCTTCATCGTGATCCTTTGCCCACTGGATCTTTTCTATTAAATCCCCCAGATTCCTTTTGAAGGGGATATAGTGTTTCCATGGCTTCAGTGCACTATAGAAGTGCTCGTAGTATGGGGAGTCTTGCTTCAGCACAAGGCTGTCCCCCAGCATGAGGTATGGGAATCTGTAGGCTGCCACCGTTCCATCTACATTCACCTGGTATTTGTATTTAAAGAAATCAAAAAAGCCGATAAATGAAGCTTTTCCCACTTCATTCTCCACTTCCCTACACAAAAATAACCTGTTATTCCAGCATCTAGAAGCTCCCGGTGTTTCCTCGACATTTGGACGAGCTTAAAACGTTCCTCCCCACTGTCTCGTCCGCCGAAGAAGCCCGGTTCAGTTTTTTTACTTCCAAGAAAGAACAAATATGTCCTTTAATTGGAAAATAAGGTACATTGGTTTACTTCTCGGGAAAATTCTCCAGGGTTTTAATGTTGTGGAGGTGGATGGGGGCGGGGAAAAGGAATGTGGGGGTGAGAGTGCCAGAAAAAAGCGGCGCCCCACAGAAAAAA
Full Trace Sequence: GGGAAACGGCTATGGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTGGGGCCCGAGCTTACTACTGGCCGTCGTTTTACGACGTCCTGAGTGGGCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGTTCCTCCCTGATGATCTTCTTCCTGTGGCACTGGCACATGGCGGAACTATCATCTGGCTGAGGGACATGTTCCATCTTCTCCCGGATTTCAGGCTTGCTTGTTTGCCGCTTGGCATAGTTCTCAAACACTTTATAATAATAGCAGTACAGCCTGTGAGGTTGCATCAGCTCTCTGACAAGTGTCTGTCCTTCCTTGGCAATCTGTCTTGCTTCTTCATCGTGATCCTTTGCCCACTGGATCTTTTCTATTAAATCCCCCAGATTCCTTTTGAAGGGGATATAGTGTTTCCATGGCTTCAGTGCACTATAGAAGTGCTCGTAGTATGGGGAGTCTTGCTTCAGCACAAGGCTGTCCCCCAGCATGAGGTATGGGAATCTGTAGGCTGCCACCGTTCCATCTACATTCACCTGGTATTTGTATTTAAAGAAATCAAAAAAGCCGATAAATGAAGCTTTTCCCACTTCATTCTCCACTTCCCTACACAAAAATAACCTGTTATTCCAGCATCTAGAAGCTCCCGGTGTTTCCTCGACATTTGGACGAGCTTAAAACGTTCCTCCCCACTGTCTCGTCCGCCGAAGAAGCCCGGTTCAGTTTTTTTACTTCCAAGAAAGAACAAATATGTCCTTTAATTGGAAAATAAGGTACATTGGTTTACTTCTCGGGAAAATTCTCCAGGGTTTTAATGTTGTGGAGGTGGATGGGGGCGGGGAAAAGGAATGTGGGGGTGAGAGTGCCAGAAAAAAGCGGCGCCCCACAGAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGTTCCTCCCTGATGATCTT