ORFeome > kdelr3 ORF1 – XORFeome v1.0

kdelr3 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: kdelr3
Gene ID: 865837
Gene Page ID: 489130
ORF Xenbase ID: 17281191

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054181
Original XGC clone length: 645

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: H06

Sequences - 5ʹ (forward) EST

Accession: JZ839070
dbEST ID: 79656772
Trimmed Sequence: ATGAATATTTTTCGGATTTTGGGGGATGTGTCCCATCTGCTGGCCATTATTATCCTGCTCCTGAAGATGTGGAAGAGCAAGTCCTGTGCTGGTATATCGGGCAAAAGCCAGCTACTCTTTGCACTGGTGTTCACAACACGGTACTTGGATCTCTTCACTGTATTTATATCTCCCTACAACACTGTAATGAAGATCATCTTCTTGGCCTGCGCATACGTTACAGTTTATTTGATCTATGGAAAATTAAGGAAGAGTTATGACAGTGAGAATGACACATTTCGTCTAGAATTCCTCCTGGTGCCAGTTATCGGACTTTCCTTCTTGGAGAACTATGAATTCACCCCTCTAGAGATCTTATGGACCTTCTCTATCTACTTGGAGTCGGTGGCCATCCTTCCCCAGCTCTTCATGATCAGTAAGACAGGAGAAGCGGAATCTATCACTACCCACTATCTCTTCTTCTTGGGCCTCTATCGTGTGCTTTACTTGGCCAACTGGATCTGGCGCTACCACACTGAGAAGTTCTACGATCAGATCGCAGTAGTGTCGGGCGTAGTGCAAACCATCTTTTACTTCGACTTCTTCTACCTCTATGTTACCAAAGTTCTCAAGGGCAAGAAGCTGAGCCTCCCTATGCCAGTGTT
Full Trace Sequence: GGGGCGTTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAATATTTTTCGGATTTTGGGGGATGTGTCCCATCTGCTGGCCATTATTATCCTGCTCCTGAAGATGTGGAAGAGCAAGTCCTGTGCTGGTATATCGGGCAAAAGCCAGCTACTCTTTGCACTGGTGTTCACAACACGGTACTTGGATCTCTTCACTGTATTTATATCTCCCTACAACACTGTAATGAAGATCATCTTCTTGGCCTGCGCATACGTTACAGTTTATTTGATCTATGGAAAATTAAGGAAGAGTTATGACAGTGAGAATGACACATTTCGTCTAGAATTCCTCCTGGTGCCAGTTATCGGACTTTCCTTCTTGGAGAACTATGAATTCACCCCTCTAGAGATCTTATGGACCTTCTCTATCTACTTGGAGTCGGTGGCCATCCTTCCCCAGCTCTTCATGATCAGTAAGACAGGAGAAGCGGAATCTATCACTACCCACTATCTCTTCTTCTTGGGCCTCTATCGTGTGCTTTACTTGGCCAACTGGATCTGGCGCTACCACACTGAGAAGTTCTACGATCAGATCGCAGTAGTGTCGGGCGTAGTGCAAACCATCTTTTACTTCGACTTCTTCTACCTCTATGTTACCAAAGTTCTCAAGGGCAAGAAGCTGAGCCTCCCTATGCCAGTGTTGCCCACTTTCCTTGAACAAGTTGGGATTTATAAGAAAGCATTGCTTAATCATTTTGTTGCCACGAAACAGGTCACTTATCATTCAAAATAAAAATCATTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATATTTTTCGGATTTTGGGG

Sequences - 3ʹ (reverse) EST

Accession: JZ839069
dbEST ID: 79656771
Trimmed Sequence: CACTGGCATAGGGAGGCTCAGCTTCTTGCCCTTGAGAACTTTGGTAACATAGAGGTAGAAGAAGTCGAAGTAAAAGATGGTTTGCACTACGCCCGACACTACTGCGATCTGATCGTAGAACTTCTCAGTGTGGTAGCGCCAGATCCAGTTGGCCAAGTAAAGCACACGATAGAGGCCCAAGAAGAAGAGATAGTGGGTAGTGATAGATTCCGCTTCTCCTGTCTTACTGATCATGAAGAGCTGGGGAAGGATGGCCACCGACTCCAAGTAGATAGAGAAGGTCCATAAGATCTCTAGAGGGGTGAATTCATAGTTCTCCAAGAAGGAAAGTCCGATAACTGGCACCAGGAGGAATTCTAGACGAAATGTGTCATTCTCACTGTCATAACTCTTCCTTAATTTTCCATAGATCAAATAAACTGTAACGTATGCGCAGGCCAAGAAGATGATCTTCATTACAGTGTTGTAGGGAGATATAAATACAGTGAAAAGATCCAAGTACCGTGTTGTGAACACCAATGCCAAGAGTAGCTGGCTTTTGCCCGATATACCAGCACAGGAATTGCTCTTCCACATCTTCAGGAACAGGAAAATAAGGCCCGCAGATGGGACACATTCCCCCAAATTCCGAAAAAAAATTCTGGGGGCCCACTTTTTTTTACCAAGTTGGGGAATTATAAAAAAAGCATTTGCTTAATCAAATTTTGTGGCAAAGAAAACGGGTTCCATAATCCCATTCCAAAATAAAAATCTCCTTTATTTT
Full Trace Sequence: GACGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACTGGCATAGGGAGGCTCAGCTTCTTGCCCTTGAGAACTTTGGTAACATAGAGGTAGAAGAAGTCGAAGTAAAAGATGGTTTGCACTACGCCCGACACTACTGCGATCTGATCGTAGAACTTCTCAGTGTGGTAGCGCCAGATCCAGTTGGCCAAGTAAAGCACACGATAGAGGCCCAAGAAGAAGAGATAGTGGGTAGTGATAGATTCCGCTTCTCCTGTCTTACTGATCATGAAGAGCTGGGGAAGGATGGCCACCGACTCCAAGTAGATAGAGAAGGTCCATAAGATCTCTAGAGGGGTGAATTCATAGTTCTCCAAGAAGGAAAGTCCGATAACTGGCACCAGGAGGAATTCTAGACGAAATGTGTCATTCTCACTGTCATAACTCTTCCTTAATTTTCCATAGATCAAATAAACTGTAACGTATGCGCAGGCCAAGAAGATGATCTTCATTACAGTGTTGTAGGGAGATATAAATACAGTGAAAAGATCCAAGTACCGTGTTGTGAACACCAATGCCAAGAGTAGCTGGCTTTTGCCCGATATACCAGCACAGGAATTGCTCTTCCACATCTTCAGGAACAGGAAAATAAGGCCCGCAGATGGGACACATTCCCCCAAATTCCGAAAAAAAATTCTGGGGGCCCACTTTTTTTTACCAAGTTGGGGAATTATAAAAAAAGCATTTGCTTAATCAAATTTTGTGGCAAAGAAAACGGGTTCCATAATCCCATTCCAAAATAAAAATCTCCTTTATTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACTGGCATAGGGAGGCT