ORFeome > kiaa1522 ORF1 – XORFeome v1.0

kiaa1522 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: kiaa1522
Gene ID: 6252789
Gene Page ID: 6469275
ORF Xenbase ID: 17281317

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC123197
Original XGC clone length: 615

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: D11

Sequences - 5ʹ (forward) EST

Accession: JZ838308
dbEST ID: 79656010
Trimmed Sequence: ATGTCCACCCACACAAGCCTCCTGCCCGAGTCGGAACCATTGCCACCCGGGCCACCCCCAGGCGCCAATGAACCCAAAAAGAAGAAAAACAAAGGGGGCACCCTGCGGCGGGCGCTGAGCTGGCTCCGAGGACGCAAGAAGAAGAAAGCGGAGGTCAAGCAGCAGCAGCAGCAGGAGGGCAAAGAACAATCAAAACCCAGTAAGGAACCCCAGCCCAGCTCAGCTCCAGATGAGGAAACTCTTGACAATTACTTCTTTCCTAGTAAACGCACAGCCCTTGTGGAGGAGATTCACAACCAAGCTCTGGAGGGCCTTAAATCACTTCAGAGAAGAGAAAAGCAGCAGAACAAGATTCAGCTTCAAGAGGAGAACCAGAGCTCTCCGCCCCAGCCAGACAGTACTGATAATGGCTTTCGTGCTCGATCTCATTCCTGTGCCACAGAGAGCACTGATGATGCCATGTCTGTTAGATCAGAAAGAATTCAGCGCAAAGGCTCAACATTTAGACCTTATGACTCCCCCAGTGTCTCCTCGGGGAGACAAGGTCGAAGGCGCAAAGAGAAAAGAGCCACTGTCATGGGAGTCCCACATCATGTTGCTGCAGAACTGGAATT
Full Trace Sequence: TCGTGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCACCCACACAAGCCTCCTGCCCGAGTCGGAACCATTGCCACCCGGGCCACCCCCAGGCGCCAATGAACCCAAAAAGAAGAAAAACAAAGGGGGCACCCTGCGGCGGGCGCTGAGCTGGCTCCGAGGACGCAAGAAGAAGAAAGCGGAGGTCAAGCAGCAGCAGCAGCAGGAGGGCAAAGAACAATCAAAACCCAGTAAGGAACCCCAGCCCAGCTCAGCTCCAGATGAGGAAACTCTTGACAATTACTTCTTTCCTAGTAAACGCACAGCCCTTGTGGAGGAGATTCACAACCAAGCTCTGGAGGGCCTTAAATCACTTCAGAGAAGAGAAAAGCAGCAGAACAAGATTCAGCTTCAAGAGGAGAACCAGAGCTCTCCGCCCCAGCCAGACAGTACTGATAATGGCTTTCGTGCTCGATCTCATTCCTGTGCCACAGAGAGCACTGATGATGCCATGTCTGTTAGATCAGAAAGAATTCAGCGCAAAGGCTCAACATTTAGACCTTATGACTCCCCCAGTGTCTCCTCGGGGAGACAAGGTCGAAGGCGCAAAGAGAAAAGAGCCACTGTCATGGGAGTCCCACATCATGTTGCTGCAGAACTGGAATTGCCAACTTTCTTGTACAAAGTGGGATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCAATATCAGTCAAATAAAATCATTATTTGCCATCCAGCCTAATAATCCCTATATTAAGTCTTATAAAATGGGTCCTAAGCGGTTTTCAAGAAAAACAAAAAAACAAATCAAAAAAAAAAAAAAAAAAAAAAAATAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCACCCACACAAGCC

Sequences - 3ʹ (reverse) EST

Accession: JZ838307
dbEST ID: 79656009
Trimmed Sequence: TTCCAGTTCTGCAGCAACATGATGTGGGACTCCCATGACAGTGGCTCTTTTCTCTTTGCGCCTTCGACCTTGTCTCCCCGAGGAGACACTGGGGGAGTCATAAGGTCTAAATGTTGAGCCTTTGCGCTGAATTCTTTCTGATCTAACAGACATGGCATCATCAGTGCTCTCTGTGGCACAGGAATGAGATCGAGCACGAAAGCCATTATCAGTACTGTCTGGCTGGGGCGGAGAGCTCTGGTTCTCCTCTTGAAGCTGAATCTTGTTCTGCTGCTTTTCTCTTCTCTGAAGTGATTTAAGGCCCTCCAGAGCTTGGTTGTGAATCTCCTCCACAAGGGCTGTGCGTTTACTAGGAAAGAAGTAATTGTCAAGAGTTTCCTCATCTGGAGCTGAGCTGGGCTGGGGTTCCTTACTGGGTTTTGATTGTTCTTTGCCCTCCTGCTGCTGCTGCTGCTTGACCTCCGCTTTCTTCTTCTTGCGTCCTCGGAACCAGCTCAGCGCCCGCCGCAAGGTGCCCCGTTTGTTTTTCTTCTTTTTGTGTTCATGGGCGCCCGGGGGTGGGCCGGGTGGCCATGGTTGCGAGTCGACCAAAAAAACGTGTGGGGGGGGGCGGGCTGCCAACTTTGTTTGTATCATTTTTGGCGTAAAGAATAGAGCTTTGGACCAGAAGTTTGGTTCCCACCCAACGGGTCGCTGAGTAGGTCGGGNNTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAAAAACACCTATACCCTTGCCTCCTCTAC
Full Trace Sequence: GGCAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCCAGTTCTGCAGCAACATGATGTGGGACTCCCATGACAGTGGCTCTTTTCTCTTTGCGCCTTCGACCTTGTCTCCCCGAGGAGACACTGGGGGAGTCATAAGGTCTAAATGTTGAGCCTTTGCGCTGAATTCTTTCTGATCTAACAGACATGGCATCATCAGTGCTCTCTGTGGCACAGGAATGAGATCGAGCACGAAAGCCATTATCAGTACTGTCTGGCTGGGGCGGAGAGCTCTGGTTCTCCTCTTGAAGCTGAATCTTGTTCTGCTGCTTTTCTCTTCTCTGAAGTGATTTAAGGCCCTCCAGAGCTTGGTTGTGAATCTCCTCCACAAGGGCTGTGCGTTTACTAGGAAAGAAGTAATTGTCAAGAGTTTCCTCATCTGGAGCTGAGCTGGGCTGGGGTTCCTTACTGGGTTTTGATTGTTCTTTGCCCTCCTGCTGCTGCTGCTGCTTGACCTCCGCTTTCTTCTTCTTGCGTCCTCGGAACCAGCTCAGCGCCCGCCGCAAGGTGCCCCGTTTGTTTTTCTTCTTTTTGTGTTCATGGGCGCCCGGGGGTGGGCCGGGTGGCCATGGTTGCGAGTCGACCAAAAAAACGTGTGGGGGGGGGCGGGCTGCCAACTTTGTTTGTATCATTTTTGGCGTAAAGAATAGAGCTTTGGACCAGAAGTTTGGTTCCCACCCAACGGGTCGCTGAGTAGGTCGGGNNTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAAAAACACCTATACCCTTGCCTCCTCTAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCCAGTTCTGCAGCAACAT