ORFeome > kifc3 ORF1 – XORFeome v1.0

kifc3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: kifc3
Gene ID: 980357
Gene Page ID: 980350
ORF Xenbase ID: 17281407

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC110977
Original XGC clone length: 2553

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: H02

Sequences - 5ʹ (forward) EST

Accession: JZ837196
dbEST ID: 79654898
Trimmed Sequence: ATGGTGGGGACTTTGAGTGAGCTTCTACAAGATACACATGAAGTGTTAGAGAGAGAAGACTTGCAAGAAGAGAGCACATTTGAGAAGCCCACAATGCAGGACATGAGAGCAACACCACTACAGAGGTCAATGAAGGTGACTCTTCAAGACCTCAGAGCAAGAAGAGAGGCAAAAGATCTTCAAGAAAAGAAACAGCCTCAAGTCAAGCAAGAGCAACATGGTTTCAGAGATCGCTTCGTAAATTTACATTTGCTGCGGCAGTTAAAAGACAGCAAACCACAGCAAGATGGAGATATAAGTGAAAGCAGGCAACTGCAGAAAAGATTAATGTATCTTCAGAAAACCAAAGATATACATGAACAAAGTAAAAAGGGTAGAAGACAAGTCCCCCATT
Full Trace Sequence: TCGAGGGCCCAATAANTGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGGGGACTTTGAGTGAGCTTCTACAAGATACACATGAAGTGTTAGAGAGAGAAGACTTGCAAGAAGAGAGCACATTTGAGAAGCCCACAATGCAGGACATGAGAGCAACACCACTACAGAGGTCAATGAAGGTGACTCTTCAAGACCTCAGAGCAAGAAGAGAGGCAAAAGATCTTCAAGAAAAGAAACAGCCTCAAGTCAAGCAAGAGCAACATGGTTTCAGAGATCGCTTCGTAAATTTACATTTGCTGCGGCAGTTAAAAGACAGCAAACCACAGCAAGATGGAGATATAAGTGAAAGCAGGCAACTGCAGAAAAGATTAATGTATCTTCAGAAAACCAAAGATATACATGAACAAAGTAAAAAGGGTAGAAGACAAGTCCCCCATTGCCGACTTTATTGTACAGATTTGGCAATATAACAACACATTGCTTATCAATTTGTTGCAACGAACATGTCGCTATCAGACAGAATACATTCATTAGTTCCCCTCCAGCTAATATACCTGATCATTCGTCGTGATTAATGGTCCGGAACGGGTTCGAAAAGCTCAAGAACCTGTCTGTGACTCATTAGGATAAAATGNAAGGGGACGTGTACTTTTAGTAAGGGAGCTAAAGCCTGGAGAGGGGGAAAAAAATAAAAACATGAAAAGGGGGGGCGGCCTCGCCTAAAAGCACGGGCCACCGGGAAGTAGAGGATAAATAAAAAAAAAAAAAGAAAAACAACACAACGAAAAGGCGGGAGGGAGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGGGGACTTTGAGTGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837195
dbEST ID: 79654897
Trimmed Sequence: TGGGGGACTTGTCCTCTGCCGCACTGAGCCCTGAGGTTTCCTCCGCAGGGAGGTGCCTTTAGTGCTGCGTAATACTGGACTTTCACTCTCTGCCAATTCAGCATTTGGTGGTGGCTGCTCAATTTTTCTTGAGGGTGCGCCCAACTCAACTGCCCGCACTCAGACTCCCCACCATGGTGACCACTTTTATGCACTAAGATGCCTCTCTGCAAGAGAAACGCTCATCGATATTTTGCACCTTAACATTCACAATCAGCTCCACTAGTATCATTATTGGAGGCCGGACCTTACGACTGTCCGTCAGTATACGATGTAATCACTGAGCTGAAATCACATCTCCCAAGCCAGACAATGAGCGGTTAATGTACTGAACTTCCCGCCGGCGTTCTCCCGCTGGAGCCGATGCTTGTTCCCGCTCCTAGCCAGATAGGTCTACAGGGTAAGTTTTCTTGTTGAGCAGATACAAGGGCTCTTCTCTCTACCCTTATCCTTACTGAAAAACCGAACAAAAGAGCGGAACCGTTTATATTGAGAATAGATTGGGGGGGGNNNGNGNGNNNTNGATNNNNANNTGNGGGGGGGGGAAAAAAAAAGANNANNNGGAGAAAAAAANNNNNCNNNNNAGNGGGGGGNNNNNNNAAAAANNNNNNNGNAAAA
Full Trace Sequence: GGTAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGGGGGACTTGTCCTCTGCCGCACTGAGCCCTGAGGTTTCCTCCGCAGGGAGGTGCCTTTAGTGCTGCGTAATACTGGACTTTCACTCTCTGCCAATTCAGCATTTGGTGGTGGCTGCTCAATTTTTCTTGAGGGTGCGCCCAACTCAACTGCCCGCACTCAGACTCCCCACCATGGTGACCACTTTTATGCACTAAGATGCCTCTCTGCAAGAGAAACGCTCATCGATATTTTGCACCTTAACATTCACAATCAGCTCCACTAGTATCATTATTGGAGGCCGGACCTTACGACTGTCCGTCAGTATACGATGTAATCACTGAGCTGAAATCACATCTCCCAAGCCAGACAATGAGCGGTTAATGTACTGAACTTCCCGCCGGCGTTCTCCCGCTGGAGCCGATGCTTGTTCCCGCTCCTAGCCAGATAGGTCTACAGGGTAAGTTTTCTTGTTGAGCAGATACAAGGGCTCTTCTCTCTACCCTTATCCTTACTGAAAAACCGAACAAAAGAGCGGAACCGTTTATATTGAGAATAGATTGGGGGGGGNNNGNGNGNNNTNGATNNNNANNTGNGGGGGGGGGAAAAAAAAAGANNANNNGGAGAAAAAAANNNNNCNNNNNAGNGGGGGGNNNNNNNAAAAANNNNNNNGNAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGGGGGACTTGTCCTCT