ORFeome > kirrel2 ORF1 – XORFeome v1.0

kirrel2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: kirrel2
Gene ID: 866535
Gene Page ID: 854069
ORF Xenbase ID: 17281419

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC057728
Original XGC clone length: 2328

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11018
Well Location: D11

Sequences - 5ʹ (forward) EST

Accession: JZ824555
dbEST ID: 79642257
Trimmed Sequence: ATGAAGAATCTCTGGCTGTTACTTTGTATCCATGTGGGGCTCCTGCTGGGCAAAAGTTTTGGGGCCCATTTCTCTCAGCAACCCTCAGACAAGGTCATAGTTGCTGGCAAATCGGTGACTCTTCCCTGCGTAGTGATTGGCTACAGAGGCGTGGTCCAATGGACGATGGACGGGCTGGCACTGGGAGCAGAAAGAGACCTTCCAGGTTGGTCCCGTTATTCTGTTGTTGGAGACCCTTCTTTAGGAGAACATAACCTGCACATTGAAGGGGTTGAGCTTAGTGATGATGCCATCTACGAGTGCCAAGCAACACAGGCAGCACTGAGGTCACAGCGGGCACGTCTCACGGTGCTACTTCCCCCAGGAGACCCAATGATACCAGGATCCCCAGTCGCCAATGTCCTGCTTGATGTACCCTACAATCTCACCTGTCTTGCTTCCGTCGCTAAGCCTGCTGCAGAGATTACCTGGTTCCGTGATGGAAAGAAGCTGGATTGGGCCATCTACACCAAGGAACTGCTGTCCGATGGCAAGAGTGAGGGTTCGGCGAGCAGTCTGTTAATCACCCCTAGTCTGGCGGATACAGGATCCAGTTACACCTGCCGAGTGAGGAATGAGGCCCTGCCAGAGGGCAGAGAGAAGTCTGTGACATTGAGTGTGCAGTATCCCCCCCAAGTAACGCTGTCGGTAGAACCCCCTACTATCACCGAGGGCGGCTCCGTCACATTTTTGTGCAGTGCAGTTTCCAACCAGAAAGTAACTGGGTACAGGTGGGGCAAAAGGGGGTGTTCCTTCTGGGCCCTGTCAAGGAAACAAAAAACCCTGGTGGAA
Full Trace Sequence: CCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGAATCTCTGGCTGTTACTTTGTATCCATGTGGGGCTCCTGCTGGGCAAAAGTTTTGGGGCCCATTTCTCTCAGCAACCCTCAGACAAGGTCATAGTTGCTGGCAAATCGGTGACTCTTCCCTGCGTAGTGATTGGCTACAGAGGCGTGGTCCAATGGACGATGGACGGGCTGGCACTGGGAGCAGAAAGAGACCTTCCAGGTTGGTCCCGTTATTCTGTTGTTGGAGACCCTTCTTTAGGAGAACATAACCTGCACATTGAAGGGGTTGAGCTTAGTGATGATGCCATCTACGAGTGCCAAGCAACACAGGCAGCACTGAGGTCACAGCGGGCACGTCTCACGGTGCTACTTCCCCCAGGAGACCCAATGATACCAGGATCCCCAGTCGCCAATGTCCTGCTTGATGTACCCTACAATCTCACCTGTCTTGCTTCCGTCGCTAAGCCTGCTGCAGAGATTACCTGGTTCCGTGATGGAAAGAAGCTGGATTGGGCCATCTACACCAAGGAACTGCTGTCCGATGGCAAGAGTGAGGGTTCGGCGAGCAGTCTGTTAATCACCCCTAGTCTGGCGGATACAGGATCCAGTTACACCTGCCGAGTGAGGAATGAGGCCCTGCCAGAGGGCAGAGAGAAGTCTGTGACATTGAGTGTGCAGTATCCCCCCCAAGTAACGCTGTCGGTAGAACCCCCTACTATCACCGAGGGCGGCTCCGTCACATTTTTGTGCAGTGCAGTTTCCAACCAGAAAGTAACTGGGTACAGGTGGGGCAAAAGGGGGTGTTCCTTCTGGGCCCTGTCAAGGAAACAAAAAACCCTGGTGGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGAATCTCTGGCTGTTAC

Sequences - 3ʹ (reverse) EST

Accession: JZ829907
dbEST ID: 79647609
Trimmed Sequence: CACATGGGTCTGCATCCGTTGCTGTGAAGGCCGGCCAAAATCACTGTGGCTGGTTAGGGAGGCATAGGAGAGCCGAGACAGAGTGGGGCCTTGGTCCATTGAGTCGAACCTGTCCGGGCGGACGTAGCTACAGAAAGCCCTGGCGTAAGGTGCTGGGTGCTGACTGGGGCCCGGTGGTAGGTGAGTGAGTCCTTGCTGTAAATGAGTTGGGCCTTGCGGTAAATGAGTTGGGCCTTGCGGTAAATGAGTTGGGCCTTGTGGTAAATGAGTTGGGCCTTGTGGCAAATAAGTGGGACCTTGAGACACATGACTTGGGCCAGGTGGGAAATGCGTGGGGCCTTGCGGCAAATGAGATGATGACCCCTGTGGCATGTGATGGCGCTCACCTCCAGATCTGGGAGTGGTGGCATACCGATGAGCATAATCGTAGATTTTAGGGGGCCCAGAAGGGGTGGGGCACAACGGCGAAAGAGAGGAAGTGGTGGAGTAGAGGGGGCGTGGCGGAGAGGAGAACTCCGGGTACATTATGGTTGTAGGCCTGGTGTCTTCATGAGCTCGGACTTTATAATAACCGTTGGTTGGGTCCTGGGGTTCGTCTGGGATGTCGCTGTGCTCCTTCTGGGATGTTCTCTGGGGATTCCGTGTCTGTGTGCAATGGGCTCCTTGAGATCCTCCTTCAGAGATCACTGGGGGTGCCCTCTTCGCTGGGGCTCGCTTCCCCGAACATGTCN
Full Trace Sequence: GGCAGGTAGCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACATGGGTCTGCATCCGTTGCTGTGAAGGCCGGCCAAAATCACTGTGGCTGGTTAGGGAGGCATAGGAGAGCCGAGACAGAGTGGGGCCTTGGTCCATTGAGTCGAACCTGTCCGGGCGGACGTAGCTACAGAAAGCCCTGGCGTAAGGTGCTGGGTGCTGACTGGGGCCCGGTGGTAGGTGAGTGAGTCCTTGCTGTAAATGAGTTGGGCCTTGCGGTAAATGAGTTGGGCCTTGCGGTAAATGAGTTGGGCCTTGTGGTAAATGAGTTGGGCCTTGTGGCAAATAAGTGGGACCTTGAGACACATGACTTGGGCCAGGTGGGAAATGCGTGGGGCCTTGCGGCAAATGAGATGATGACCCCTGTGGCATGTGATGGCGCTCACCTCCAGATCTGGGAGTGGTGGCATACCGATGAGCATAATCGTAGATTTTAGGGGGCCCAGAAGGGGTGGGGCACAACGGCGAAAGAGAGGAAGTGGTGGAGTAGAGGGGGCGTGGCGGAGAGGAGAACTCCGGGTACATTATGGTTGTAGGCCTGGTGTCTTCATGAGCTCGGACTTTATAATAACCGTTGGTTGGGTCCTGGGGTTCGTCTGGGATGTCGCTGTGCTCCTTCTGGGATGTTCTCTGGGGATTCCGTGTCTGTGTGCAATGGGCTCCTTGAGATCCTCCTTCAGAGATCACTGGGGGTGCCCTCTTCGCTGGGGCTCGCTTCCCCGAACATGTCN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACATGGGTCTGCATCCGTT