ORFeome > klf2 ORF1 – XORFeome v1.0

klf2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: klf2
Gene ID: 485039
Gene Page ID: 485034
ORF Xenbase ID: 17281461

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043732
Original XGC clone length: 1122

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11015
Well Location: C03

Sequences - 5ʹ (forward) EST

Accession: JZ824213
dbEST ID: 79641915
Trimmed Sequence: ATGGCTCTGAGCGAGACCATTCTCCCTTCTTTCGCTACGTTTGCAAGCCAAGATAGGTGGAAGTGTGAGTATGAGTCCAAGTCTCCCCGCGGCAGCTGTGGCATTCCAGATGTAATGCAAAGCCCAGACCCCTTCTCTTCTAGGAAGGAAGACGAAGATTTAAACAATGTTCTGGAATTTGTGTTGGCCATGGGCTGTGACAAAAGTCTCCAAACCTGTGGAGACTTTTCAATGGCACCTTCCGAGTCCTGCACTTACTACCAAACAAGCCCTTCTCAGGGAAGCTACAGCACAGACCAAAGCCCTCCTCCTTATAGTTCGGGTAGCCTCATGACTGAACTTATTAGGTCTGACATGGACAACTACTGCCATCCTAGCAATGTTCAAGGGAGATTCTTTGTGTCATCAAATTTTGACTTTCCAGATACAATCAAAGCAGAACCTGACATGGATTCATATGGACCAGTTATGGGTATGGTTCCCCAGTCCTGCACAAAGATCAAGCAAGAGGGCAGTACTGCTTGTATGATGGCATATGAACAGCCTAGACTTGCTAATTCTCCTCAGATGGGTGGCCCTGACACCCCTCCTTTGAGCCCCGATGACATAATGTTAAGTGAATGCCAGTCCCAGTTGATGTGCCACCCTTCACTGCCTTATGCTCCTAATTATCCGCATGCTGGCTTCCATCACCAGTCACTTATCCAGTATCAAAATACCTCCCCAGTATGGCATGTTTTGAGGACAATATGCCCCTGCAAACCTTCTATTGGCCAGGGGGCATGAATAACAACCTTCCCTGGCCCCCCCTTTTGGGAAATTATTGGG
Full Trace Sequence: GGCCATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTCTGAGCGAGACCATTCTCCCTTCTTTCGCTACGTTTGCAAGCCAAGATAGGTGGAAGTGTGAGTATGAGTCCAAGTCTCCCCGCGGCAGCTGTGGCATTCCAGATGTAATGCAAAGCCCAGACCCCTTCTCTTCTAGGAAGGAAGACGAAGATTTAAACAATGTTCTGGAATTTGTGTTGGCCATGGGCTGTGACAAAAGTCTCCAAACCTGTGGAGACTTTTCAATGGCACCTTCCGAGTCCTGCACTTACTACCAAACAAGCCCTTCTCAGGGAAGCTACAGCACAGACCAAAGCCCTCCTCCTTATAGTTCGGGTAGCCTCATGACTGAACTTATTAGGTCTGACATGGACAACTACTGCCATCCTAGCAATGTTCAAGGGAGATTCTTTGTGTCATCAAATTTTGACTTTCCAGATACAATCAAAGCAGAACCTGACATGGATTCATATGGACCAGTTATGGGTATGGTTCCCCAGTCCTGCACAAAGATCAAGCAAGAGGGCAGTACTGCTTGTATGATGGCATATGAACAGCCTAGACTTGCTAATTCTCCTCAGATGGGTGGCCCTGACACCCCTCCTTTGAGCCCCGATGACATAATGTTAAGTGAATGCCAGTCCCAGTTGATGTGCCACCCTTCACTGCCTTATGCTCCTAATTATCCGCATGCTGGCTTCCATCACCAGTCACTTATCCAGTATCAAAATACCTCCCCAGTATGGCATGTTTTGAGGACAATATGCCCCTGCAAACCTTCTATTGGCCAGGGGGCATGAATAACAACCTTCCCTGGCCCCCCCTTTTGGGAAATTATTGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTCTGAGCGAGACCATT

Sequences - 3ʹ (reverse) EST

Accession: JZ829522
dbEST ID: 79647224
Trimmed Sequence: CATGTGCCTCTTCATGTGCAGTGCAAGGTGGTCAGATCGAGAGAAGGCACGGTCACACAGATGGCACTGGAAGGGCCGGTGGCCAGTATGCTTACGGAAATGGCGCGTTAGTTCATCAGATCGGGCAAATTTCCAGCCACATCCTTCCCAGTTGCAGTGATAAGGCTTCTCACCTGTGTGGGTTCTGAGATGGGCTTTCAAGTGGGAACTCTTTGTGTAGGTCTTCCCACAACCAGCATAAGAGCAAGTGTGTGACGCCGTCCTTTTCCTAGGCCAAGATCTGCGGCCTCTCTTTGGCTTGGTTTCCAATATTTCCAAAGGGGAGCAGGGAGGTGTTATCATGCCCCTGGCAATAGAAGGTTGCATGGGCATATTGTCCTCAAACATGCCATACTGGGAGGTATTTTGATACTGGATAGGTGACTGGTGATGGAAGCCAGCATGCGGATAATTAGGAGCATAAGGCAGTGAAGGGTGGCACATCAACTGGGACTGGCATTCACTTAACATTATGTCATCGGGGCTCAAAGGAGGGGTGTCAGGGCCACCCATCTGAGGAGAATTAGCAAGTCTAGGCTGTTCATATGCCATCATACAAGCAGTACTGCCCTCTTGCTTGATCTTTGTGCANGACTGGGGGACCATACCCATAACTGGGTCATATGAATCCATGTCAGGTTCTGCTTTGATTGGTATCTGGGAAAGTCCAAATTTTGAAGGACACAA
Full Trace Sequence: CTGGCGGGAAACAGCTATGACCATGTAATACGACTCACTATANGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATGTGCCTCTTCATGTGCAGTGCAAGGTGGTCAGATCGAGAGAAGGCACGGTCACACAGATGGCACTGGAAGGGCCGGTGGCCAGTATGCTTACGGAAATGGCGCGTTAGTTCATCAGATCGGGCAAATTTCCAGCCACATCCTTCCCAGTTGCAGTGATAAGGCTTCTCACCTGTGTGGGTTCTGAGATGGGCTTTCAAGTGGGAACTCTTTGTGTAGGTCTTCCCACAACCAGCATAAGAGCAAGTGTGTGACGCCGTCCTTTTCCTAGGCCAAGATCTGCGGCCTCTCTTTGGCTTGGTTTCCAATATTTCCAAAGGGGAGCAGGGAGGTGTTATCATGCCCCTGGCAATAGAAGGTTGCATGGGCATATTGTCCTCAAACATGCCATACTGGGAGGTATTTTGATACTGGATAGGTGACTGGTGATGGAAGCCAGCATGCGGATAATTAGGAGCATAAGGCAGTGAAGGGTGGCACATCAACTGGGACTGGCATTCACTTAACATTATGTCATCGGGGCTCAAAGGAGGGGTGTCAGGGCCACCCATCTGAGGAGAATTAGCAAGTCTAGGCTGTTCATATGCCATCATACAAGCAGTACTGCCCTCTTGCTTGATCTTTGTGCANGACTGGGGGACCATACCCATAACTGGGTCATATGAATCCATGTCAGGTTCTGCTTTGATTGGTATCTGGGAAAGTCCAAATTTTGAAGGACACAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATGTGCCTCTTCATGTGCAGT