ORFeome > klf4 ORF1 – XORFeome v1.0

klf4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: klf4
Gene ID: 6255489
Gene Page ID: 1015048
ORF Xenbase ID: 17281467

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC055956
Original XGC clone length: 1242

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11019
Well Location: B04

Sequences - 5ʹ (forward) EST

Accession: JZ824560
dbEST ID: 79642262
Trimmed Sequence: ATGAGTGTGGCTTTCTCAACCCTACAACCAGTGGAAGACAAGCAGCTTGGCATGGTATCGGTCATGGCAATGGAGGAGCTGAGGCCACTGGCTGATATGAGCTACACCATGATTGAGCATTGCATTAAGAAGGAAGAGGATGACCTGGGCAAATTCGTTGACTTGGACTTTATATTGGCTCACACGAGCAGCAGCCAGAATGGTGGCACGCCGGTAGGACATGGTGGCGCCTACCCATTGCCCGAGACCCCTGAGAGCTGTAGTACCACCTATGATAGCGATGGATCCTACACTGCCAGTCAGAAATACGGAGGGGGGAGCTTTGCCGGGAGCCCCCATCACAGTTATGTGGCGGAGCTGCTGACCCCAGATGTGCCCTGCATAGAGGTGTCCCCTGACTTTGGACTAAAGGCCGGCATGCACAGCAGGAAGTACACTGAGCTCAGAGTATCTGCCATGGACACCCCTGGGCATCTGCCATCGGAGCACCTACAGCACCTGAGCCATAGAATTAAAAAGGAGCGACCTGAGCAGTCGTGCATGCTGGGTGCCGGCTCCCCTACTTCCCCAGACTGTATTAGCCCCATCATGGAGCAGAAGGCTGGCATCATGCAAATGCACGGCCAACTCCTTCCCAATCCTGCCTATTCTCAGCACAGGCTCAGCCTCCCAGTACCCACAGAGGATATGCCCCCCCATGGACTGCACATGATCCCTGACATGCACTGGCTGTCCCCTATGTCAATGGCACAGCATTACCCCAATGGGCAGCCCCTACCCAAAATTCTTTTACAGACCCGCCCCAACTGGCAGGTTCTTGGTGGAAAATTTTGGAT
Full Trace Sequence: AGTTGATTTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAGAAAGTTGGCACCATGAGTGTGGCTTTCTCAACCCTACAACCAGTGGAAGACAAGCAGCTTGGCATGGTATCGGTCATGGCAATGGAGGAGCTGAGGCCACTGGCTGATATGAGCTACACCATGATTGAGCATTGCATTAAGAAGGAAGAGGATGACCTGGGCAAATTCGTTGACTTGGACTTTATATTGGCTCACACGAGCAGCAGCCAGAATGGTGGCACGCCGGTAGGACATGGTGGCGCCTACCCATTGCCCGAGACCCCTGAGAGCTGTAGTACCACCTATGATAGCGATGGATCCTACACTGCCAGTCAGAAATACGGAGGGGGGAGCTTTGCCGGGAGCCCCCATCACAGTTATGTGGCGGAGCTGCTGACCCCAGATGTGCCCTGCATAGAGGTGTCCCCTGACTTTGGACTAAAGGCCGGCATGCACAGCAGGAAGTACACTGAGCTCAGAGTATCTGCCATGGACACCCCTGGGCATCTGCCATCGGAGCACCTACAGCACCTGAGCCATAGAATTAAAAAGGAGCGACCTGAGCAGTCGTGCATGCTGGGTGCCGGCTCCCCTACTTCCCCAGACTGTATTAGCCCCATCATGGAGCAGAAGGCTGGCATCATGCAAATGCACGGCCAACTCCTTCCCAATCCTGCCTATTCTCAGCACAGGCTCAGCCTCCCAGTACCCACAGAGGATATGCCCCCCCATGGACTGCACATGATCCCTGACATGCACTGGCTGTCCCCTATGTCAATGGCACAGCATTACCCCAATGGGCAGCCCCTACCCAAAATTCTTTTACAGACCCGCCCCAACTGGCAGGTTCTTGGTGGAAAATTTTGGAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTGTGGCTTTCTCAACCCTA

Sequences - 3ʹ (reverse) EST

Accession: JZ829911
dbEST ID: 79647613
Trimmed Sequence: CATGTGTCTCTTCATATGCAGGGCCAGGTGATCGGATCGGGAGAAGGCTCTCTCACACAGATGGCACTGGAAGGGTCGGTGACCCGTGTGCTTGCGAAAGTGACGGGTGAGTTCGTCAGATCTTGCGAATTTCCATCCGCAGCCCTCCCAGTTACAGTGATATGGTTTCTCTCCTGTATGTGTTCGCATATGAGCCTTCAGGTGGGAGCTCTTGGTGTAGGTTTTGCCGCAGCCCGGGTACTCGCAGCTGTGAGTGGCAGTTCTTTTCTTGGCCCAAGATCTCCGACCCCTCTTTGGTTTGCAGTCATCCGTGGCAGCCATGGCAGGATAATACTCGAGCAAGGGGGAGGAGGGAGGGGTGACAATCATTCCATGCATAGATGGGTGAACCTTCATGGGGTCTCTGTAAACTCCAAATTGTCCATGAAACTGCACGTTGGGCTGGCTGGTAAAATGAGTTTGGTAGGGGCTTGCCATTGGGTAATGCTGTGCCATTGACATAAGGGACAGGCAGTGCATGTCAGGGATCATGTGGCAGTCATTGGGGGGCATATCCTCTGTGGGTACTGGGGGGCTGAGCCTGTGCTGAGAATAGGCAGGAATGGGGAAGGAGTTGGCCGTGCATTTGCATGATGCCAGCCTTTCTGCTCATGATGGGGCTAATACAGTCTGGGGAAAGTAGGGGAGCCGGCACCCAGCAAGCAACAACTGCTCAGGGCGCCTCCTT
Full Trace Sequence: GGGCAGGGAAACGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATGTGTCTCTTCATATGCAGGGCCAGGTGATCGGATCGGGAGAAGGCTCTCTCACACAGATGGCACTGGAAGGGTCGGTGACCCGTGTGCTTGCGAAAGTGACGGGTGAGTTCGTCAGATCTTGCGAATTTCCATCCGCAGCCCTCCCAGTTACAGTGATATGGTTTCTCTCCTGTATGTGTTCGCATATGAGCCTTCAGGTGGGAGCTCTTGGTGTAGGTTTTGCCGCAGCCCGGGTACTCGCAGCTGTGAGTGGCAGTTCTTTTCTTGGCCCAAGATCTCCGACCCCTCTTTGGTTTGCAGTCATCCGTGGCAGCCATGGCAGGATAATACTCGAGCAAGGGGGAGGAGGGAGGGGTGACAATCATTCCATGCATAGATGGGTGAACCTTCATGGGGTCTCTGTAAACTCCAAATTGTCCATGAAACTGCACGTTGGGCTGGCTGGTAAAATGAGTTTGGTAGGGGCTTGCCATTGGGTAATGCTGTGCCATTGACATAAGGGACAGGCAGTGCATGTCAGGGATCATGTGGCAGTCATTGGGGGGCATATCCTCTGTGGGTACTGGGGGGCTGAGCCTGTGCTGAGAATAGGCAGGAATGGGGAAGGAGTTGGCCGTGCATTTGCATGATGCCAGCCTTTCTGCTCATGATGGGGCTAATACAGTCTGGGGAAAGTAGGGGAGCCGGCACCCAGCAAGCAACAACTGCTCAGGGCGCCTCCTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATGTGTCTCTTCATATGCAGG