ORFeome > klf6 ORF1 – XORFeome v1.0

klf6 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: klf6
Gene ID: 6254475
Gene Page ID: 986302
ORF Xenbase ID: 17281485

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044713
Original XGC clone length: 852

Human orthology & disease relationships

NCBI Entrez ID: 1316
Ensembl gene IDs: ENSG00000067082
Directly associated (OMIM) disease MIM numbers: 176807,613659
Indirectly associated (Lage, et al.) disease MIM numbers: 109800,114480,132600,155255,259500,609048

Library Location

Plate ID: GDExl11017
Well Location: H04

Sequences - 5ʹ (forward) EST

Accession: JZ824398
dbEST ID: 79642100
Trimmed Sequence: ATGGATGTTCTACCCATGTGCAGCATTTTCCAGGAGCTTCAGATTGTGCATGACACTGGCTATTTCTCTGCTTTGCCTTCCCTGGAGGAATATTGGCAACAGACATGTCTTGAGTTGGAACGGTACCTGCAAAGTGAACCGTGCTATGTGTCTGCGGCTGAATTTAAATTCGATCGAGAAGAGGAACTTTGGACCAAATTTATCTTCGCGTGTGAAAAAAAAGAGGAACCCGACCAGAACATCAGTTGTGTTTCTCCAGAGGACATTAGTGACTGCCAGAATTCAGAAACTAACAGCTTGAACTCTGATGTCAGCAGCGAGTCTTCGGATAGTTCTGAAGAACTTTCACCTACTTCAAAATTTACCTCAGATACTATAAGCGATGTACTAGCCACCAATGGAACTCTTAGTTCTTCTGTTACTTCAACTCCTCCATCTTCTCCAGAGCAGAGCAAAGACCCATCTTGTCACTTGTGGAATGCAGTTACTGGGGAGCTACATTCACCCGGGAAGGTGCGATGTGGTTCCTTTGGAAAGACTCTAGAACACGGTAGCCCAACGGGTGGAGAAAGCTCACCGGACGGCAGGAAACGTATCCATAAGTGTCTTTTCAATGGCTGCAAGAAATTTACACCNAGAGTTCTCACTTGAAAGCACACCAGCGCACTCACACAGGAGAAAAGCTTACAGAGCTCATGGGGAAGTTGGTGAGTGGCGTTTTTGCAGGAGTGACGAATTAACCAGACACTTCCGTTAACACACCGGTGCCCAACCAATTTAATGCTCCAACCGTGTGGCAGGGGGT
Full Trace Sequence: CAATATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATGTTCTACCCATGTGCAGCATTTTCCAGGAGCTTCAGATTGTGCATGACACTGGCTATTTCTCTGCTTTGCCTTCCCTGGAGGAATATTGGCAACAGACATGTCTTGAGTTGGAACGGTACCTGCAAAGTGAACCGTGCTATGTGTCTGCGGCTGAATTTAAATTCGATCGAGAAGAGGAACTTTGGACCAAATTTATCTTCGCGTGTGAAAAAAAAGAGGAACCCGACCAGAACATCAGTTGTGTTTCTCCAGAGGACATTAGTGACTGCCAGAATTCAGAAACTAACAGCTTGAACTCTGATGTCAGCAGCGAGTCTTCGGATAGTTCTGAAGAACTTTCACCTACTTCAAAATTTACCTCAGATACTATAAGCGATGTACTAGCCACCAATGGAACTCTTAGTTCTTCTGTTACTTCAACTCCTCCATCTTCTCCAGAGCAGAGCAAAGACCCATCTTGTCACTTGTGGAATGCAGTTACTGGGGAGCTACATTCACCCGGGAAGGTGCGATGTGGTTCCTTTGGAAAGACTCTAGAACACGGTAGCCCAACGGGTGGAGAAAGCTCACCGGACGGCAGGAAACGTATCCATAAGTGTCTTTTCAATGGCTGCAAGAAATTTACACCNAGAGTTCTCACTTGAAAGCACACCAGCGCACTCACACAGGAGAAAAGCTTACAGAGCTCATGGGGAAGTTGGTGAGTGGCGTTTTTGCAGGAGTGACGAATTAACCAGACACTTCCGTTAACACACCGGTGCCCAACCAATTTAATGCTCCAACCGTGTGGCAGGGGGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATGTTCTACCCATGTG

Sequences - 3ʹ (reverse) EST

Accession: JZ829755
dbEST ID: 79647457
Trimmed Sequence: GATGTGCCTCTTCATGTGAAGGGCCAGGTGATCTGACCTGGAAAAACACCTGTCACAGTGTGAGCACTTAAATGGTTTGGCACCGGTGTGTTTACGGAAGTGTCTGGTTAATTCGTCACTCCTTGCAAAACGCCACTCACAACCTTCCCATGAGCATCTGTAAGGCTTTTCTCCTGTGTGAGTGCGCTGGTGTGCTTTCAAGTGAGAACTCTTGGTGTAAACTTTCTTGCAGCCATTGAAAAGACACTTATGGATACGTTTCCTGCCGTCCGGTGAGCTTTCTCCACCCGTTGGGCTACCGTGTTCTAGAGTCTTTCCAAAGGAACCACATCGCACCTTCCCGGGTGAATGTAGCTCCCCAGTAACTGCATTCCACAAGTGACAAGATGGGTCTTTGCTCTGCTCTGGAGAAGATGGAGGAGTTGAAGTAACAGAAGAACTAAGAGTTCCATTGGTGGCTAGTACATCGCTTATAGTATCTGAGGTAAATTTTGAAGTANGTGAAAGTTCTTCAGAACTATCCGAAGACTCGCTGCTGACATCAGAGTTCAAGCTGTTAGTTTCTGAATTCTGGCAGTCACTAATGTCCTCTGGAGAAACACACTGATGTTCTGGTCGGGTTCCTCTTTTTTTCACACGCGAAGAATAATTTGGTCCAAAGTTCCTCTTCTCGATCGAATTTAAATTCAGCCCCCAAAACATAGCACGGGTTTCATTTTGCAGGTTCCCTTTCCCCACCCCAAAGAAC
Full Trace Sequence: GCACGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGATGTGCCTCTTCATGTGAAGGGCCAGGTGATCTGACCTGGAAAAACACCTGTCACAGTGTGAGCACTTAAATGGTTTGGCACCGGTGTGTTTACGGAAGTGTCTGGTTAATTCGTCACTCCTTGCAAAACGCCACTCACAACCTTCCCATGAGCATCTGTAAGGCTTTTCTCCTGTGTGAGTGCGCTGGTGTGCTTTCAAGTGAGAACTCTTGGTGTAAACTTTCTTGCAGCCATTGAAAAGACACTTATGGATACGTTTCCTGCCGTCCGGTGAGCTTTCTCCACCCGTTGGGCTACCGTGTTCTAGAGTCTTTCCAAAGGAACCACATCGCACCTTCCCGGGTGAATGTAGCTCCCCAGTAACTGCATTCCACAAGTGACAAGATGGGTCTTTGCTCTGCTCTGGAGAAGATGGAGGAGTTGAAGTAACAGAAGAACTAAGAGTTCCATTGGTGGCTAGTACATCGCTTATAGTATCTGAGGTAAATTTTGAAGTANGTGAAAGTTCTTCAGAACTATCCGAAGACTCGCTGCTGACATCAGAGTTCAAGCTGTTAGTTTCTGAATTCTGGCAGTCACTAATGTCCTCTGGAGAAACACACTGATGTTCTGGTCGGGTTCCTCTTTTTTTCACACGCGAAGAATAATTTGGTCCAAAGTTCCTCTTCTCGATCGAATTTAAATTCAGCCCCCAAAACATAGCACGGGTTTCATTTTGCAGGTTCCCTTTCCCCACCCCAAAGAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATGTGCCTCTTCATGTG