ORFeome > klf7 ORF1 – XORFeome v1.0

klf7 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: klf7
Gene ID: 1012738
Gene Page ID: 1012734
ORF Xenbase ID: 17281491

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054963
Original XGC clone length: 882

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: A03

Sequences - 5ʹ (forward) EST

Accession: JZ839293
dbEST ID: 79656995
Trimmed Sequence: ATGGATGTTTTGGCTAGTTATAGTATATTCCAGGAGCTCCAGATTGTACATGACACGGGCTACTTCTCAGCAATGCCATCCCTGGAGGAAAATTGGCAGCAGACATGCCTGGAACTGGAGCGGTATTTGCAGACAGAACCTAAAAAAATGTCAGAAACATTTGGAGAAGATTTGGACTGTTTTCTGAACACCTCCATTGCTCAGGCTGCTGATGGCACTGCTTGCAAGATTGATTCAATTGTAATTCCAGTGGATATTAGTACCTATGAAAAACGTCCAAGCATGGATGTGTTACTTTCACAAGACAAGTTACTATCAGAGACGTGCGTCAGCCTACAGCCCGCTACAGAATGCTATACGTCTGTAAACCAAGCGCAGTTGAATGCAGTTACATCTCTAACGCCGCCATCATCCCCAGAACTTAGCAGGCATCTAGTCAAAACCCCACAGTCCCTTTCTGTTGTAGATGGCACCGTGACCTTAAAACTAGTTGCAAAAAAGGCCACGGTTAGCTTGGGGAAGGCTGCAGAGTCAGCATCAACGGCGGTGACGTCAAAGTGCGGCCAGAGTGATAGTGAACAGACTGGGGGCCCAGGAGAAGCTTCCCCTGAAAATAAGAAAAGGGTTCATCGCTGGCCATTTAATGGCTGCAGGAAAGTCTACACAAAGAAGTCACATTTTGAAAGCCCACCCGAGGACNCACAACAGGTGAGAAAGCCCTACAAGTGGCTCCCGGGAAAGGGTGCGGAGTGGGGTTCCTGCCTCAAATTGATGAAACTGAACAAGGGCCCCTACCGGAAAGGAAAACAAGGGGGCCAAA
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATGTTTTGGCTAGTTATAGTATATTCCAGGAGCTCCAGATTGTACATGACACGGGCTACTTCTCAGCAATGCCATCCCTGGAGGAAAATTGGCAGCAGACATGCCTGGAACTGGAGCGGTATTTGCAGACAGAACCTAAAAAAATGTCAGAAACATTTGGAGAAGATTTGGACTGTTTTCTGAACACCTCCATTGCTCAGGCTGCTGATGGCACTGCTTGCAAGATTGATTCAATTGTAATTCCAGTGGATATTAGTACCTATGAAAAACGTCCAAGCATGGATGTGTTACTTTCACAAGACAAGTTACTATCAGAGACGTGCGTCAGCCTACAGCCCGCTACAGAATGCTATACGTCTGTAAACCAAGCGCAGTTGAATGCAGTTACATCTCTAACGCCGCCATCATCCCCAGAACTTAGCAGGCATCTAGTCAAAACCCCACAGTCCCTTTCTGTTGTAGATGGCACCGTGACCTTAAAACTAGTTGCAAAAAAGGCCACGGTTAGCTTGGGGAAGGCTGCAGAGTCAGCATCAACGGCGGTGACGTCAAAGTGCGGCCAGAGTGATAGTGAACAGACTGGGGGCCCAGGAGAAGCTTCCCCTGAAAATAAGAAAAGGGTTCATCGCTGGCCATTTAATGGCTGCAGGAAAGTCTACACAAAGAAGTCACATTTTGAAAGCCCACCCGAGGACNCACAACAGGTGAGAAAGCCCTACAAGTGGCTCCCGGGAAAGGGTGCGGAGTGGGGTTCCTGCCTCAAATTGATGAAACTGAACAAGGGCCCCTACCGGAAAGGAAAACAAGGGGGCCAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATGTTTTGGCTAGTTATAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ839292
dbEST ID: 79656994
Trimmed Sequence: AATATGTCTCTTCATATGGAGGGCAAGGTGATCAGACCTTGAAAAACACCTGTCGCAGTGGTTGCATTTGAATGGCTTTGCCCCTGTGTGCTTCCTGTAGTGCCTTGTCAGTTCATCACTTCGAGCAGAACGCCACTCGCACCCTTCCCAGGAGCACTTGTATGGCTTCTCACCTGTGTGTGTCCTCTGGTGGGCTTTCAAATGTGAACTCTTTGTGTAGACTTTCCTGCAGCCATTAAATTGGCAGCGATGAACCCTTTTCTTATTTTCAGGGGAAGCTTCTCCTGGGCCCCCAGTCTGTTCACTATCACTCTGGCCGCACTTTGACGTCACCGCCGTTGATGCTGACTCTGCAGCCTTCCCCAAGCTAACCGTGGCCTTTTTTGCAACTAGTTTTAAGGTCACGGTGCCATCTACAACAGAAAGGGACTGTGGGGTTTTGACTAGATGCCTGCTAAGTTCTGGGGATGATGGCGGCGTTAGAGATGTAACTGCATTCAACTGCGCTTGGTTTACAGACGTATAGCATTCTGTAGCGGGCTGTAGGCTGACGCACGTCTCTGAAAGTAACTTGTCTTGTGAAAGTAACACATCCATGCTTGGAACTTTTTTATAGGTACAAATAACCACTGGGAATTACAATTGAATCAATCTTTGCAACCCAGGGCCATCAGCACCCTGAACCAATGAAAGTTGGTTAAAAAAAACATTCCAAATTCCTTTCTCCAAAAGTTTTTCTTAAAATTTTTTTTTAAGGTTTCCGTTCTGTGCCAAA
Full Trace Sequence: GACGGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAATATGTCTCTTCATATGGAGGGCAAGGTGATCAGACCTTGAAAAACACCTGTCGCAGTGGTTGCATTTGAATGGCTTTGCCCCTGTGTGCTTCCTGTAGTGCCTTGTCAGTTCATCACTTCGAGCAGAACGCCACTCGCACCCTTCCCAGGAGCACTTGTATGGCTTCTCACCTGTGTGTGTCCTCTGGTGGGCTTTCAAATGTGAACTCTTTGTGTAGACTTTCCTGCAGCCATTAAATTGGCAGCGATGAACCCTTTTCTTATTTTCAGGGGAAGCTTCTCCTGGGCCCCCAGTCTGTTCACTATCACTCTGGCCGCACTTTGACGTCACCGCCGTTGATGCTGACTCTGCAGCCTTCCCCAAGCTAACCGTGGCCTTTTTTGCAACTAGTTTTAAGGTCACGGTGCCATCTACAACAGAAAGGGACTGTGGGGTTTTGACTAGATGCCTGCTAAGTTCTGGGGATGATGGCGGCGTTAGAGATGTAACTGCATTCAACTGCGCTTGGTTTACAGACGTATAGCATTCTGTAGCGGGCTGTAGGCTGACGCACGTCTCTGAAAGTAACTTGTCTTGTGAAAGTAACACATCCATGCTTGGAACTTTTTTATAGGTACAAATAACCACTGGGAATTACAATTGAATCAATCTTTGCAACCCAGGGCCATCAGCACCCTGAACCAATGAAAGTTGGTTAAAAAAAACATTCCAAATTCCTTTCTCCAAAAGTTTTTCTTAAAATTTTTTTTTAAGGTTTCCGTTCTGTGCCAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAATATGTCTCTTCATATGGAGGG