ORFeome > klhdc3 ORF1 – XORFeome v1.0

klhdc3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: klhdc3
Gene ID: 5879442
Gene Page ID: 5879386
ORF Xenbase ID: 17281509

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056132
Original XGC clone length: 1137

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11020
Well Location: E07

Sequences - 5ʹ (forward) EST

Accession: JZ824688
dbEST ID: 79642390
Trimmed Sequence: ATGCCGCGGTGGACGGTTCATCTAGAGGGGGGTCCACGAAGAGTAAATCATGCTGCAGTTGCTATAGGAGTGGGAGTATTTTCCTTTGGCGGTTACTGCTCTGGGGAGGACTACGAAACTCTGAGGCAAATCGATGTGCATGTGTTCAATGCAGTATCACTTCGCTGGCGGAAACTCCCGCCCTCATCCTGTGCTCCGTCCAAAGTCCCCTACATGAGATATGGACACACGGCAGTGCTGATCGATGACATCATCTATATCTGGGGTGGGCGCAATGACACGGAGGGTGCTTGTAATGTTCTCTACACCTTTCACACAGGAACACATCAGTGGGCAACGCCTCAAGTCACTGGACAGATCCCTGGGGCTCGGGATGGCCACTCCGCCTGTGTCTATGAGAGGACAATGTACATATTTGGTGGATATGAGCAGCTGGCCGACTGTTTCTCCAATGAAATCCATAAACTGGACACGCGATCCATGAACTGGGCCTTAGTGAGAGCCAAGGGCAATGCTGCCCGCTGGAGAGATTTCCACTCTGCCACGGTAATCGGCAGCCGAATGTACGTGTTTTGGGGGGTCGGGCCGACCGAGCTGGACCTTTCCACTCCAACAATGAGATTTACTGCAATCAGAATTCGTGTGTTTGACCTCCAGATTGAGACTTGGCTGGACCCTCCTGAGAGCACCAATCCCCCCGAGGGGAGACGCAGCACTCCAGCCTTGCGTACCAGGGGGAGACTCTATGTGTTCGGCGGATACCATGCTCGACTTAATCGCCCACTTCTAAGACCTTTGGGAATTTTCACCCCAAATCGGGCCGAAGGGCCCCCAAAAAA
Full Trace Sequence: AGTGGAATTTTATTTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCGCGGTGGACGGTTCATCTAGAGGGGGGTCCACGAAGAGTAAATCATGCTGCAGTTGCTATAGGAGTGGGAGTATTTTCCTTTGGCGGTTACTGCTCTGGGGAGGACTACGAAACTCTGAGGCAAATCGATGTGCATGTGTTCAATGCAGTATCACTTCGCTGGCGGAAACTCCCGCCCTCATCCTGTGCTCCGTCCAAAGTCCCCTACATGAGATATGGACACACGGCAGTGCTGATCGATGACATCATCTATATCTGGGGTGGGCGCAATGACACGGAGGGTGCTTGTAATGTTCTCTACACCTTTCACACAGGAACACATCAGTGGGCAACGCCTCAAGTCACTGGACAGATCCCTGGGGCTCGGGATGGCCACTCCGCCTGTGTCTATGAGAGGACAATGTACATATTTGGTGGATATGAGCAGCTGGCCGACTGTTTCTCCAATGAAATCCATAAACTGGACACGCGATCCATGAACTGGGCCTTAGTGAGAGCCAAGGGCAATGCTGCCCGCTGGAGAGATTTCCACTCTGCCACGGTAATCGGCAGCCGAATGTACGTGTTTTGGGGGGTCGGGCCGACCGAGCTGGACCTTTCCACTCCAACAATGAGATTTACTGCAATCAGAATTCGTGTGTTTGACCTCCAGATTGAGACTTGGCTGGACCCTCCTGAGAGCACCAATCCCCCCGAGGGGAGACGCAGCACTCCAGCCTTGCGTACCAGGGGGAGACTCTATGTGTTCGGCGGATACCATGCTCGACTTAATCGCCCACTTCTAAGACCTTTGGGAATTTTCACCCCAAATCGGGCCGAAGGGCCCCCAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCGCGGTGGACGGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ830040
dbEST ID: 79647742
Trimmed Sequence: TCCGTGCGAGGACAGCAGGGGCCGGCTAATATTACTGTTTGTTGTCATTGCTGAGAGCTCCCATCTGATGTCATGGGGCAGACACGACTGGTCAAGATTGTGGTGCAGCACGGCTAGTTTGCACAGTGTCTTCAGACTGGGACTGAAGTCCAGGATATACAGGTCAGAATGATCCATCAAATAAAACTCGTCCTGCAGGTCCTGATCCTGGGAAGGGCTTGTGCCACCAAAAAGAAGGATTTTGTCCCCAACAACACAACAGCACTGCCTGCGCCGTGCACATGGCCCCTTCCCTTGGACTTCTACTCGCTGCCATCGGCCTGACTCTGGTGTGAATTTCCAAAGGTCTTGAAAGTGGCGATTAAGTCGAGCATTGTATCCGCCGAACACATAGAGCTCCCCCTGGTACGCAAAGGCTGAGTGGCTGCGTCTCCCCTCGGGGGGATTGGTGCTCTCAGGAGGGTCCAGCCAAGTCTCAATCTGGAGGTCAAACACACGAATCTGATTGCAGTAAATCTCATTGTTGGAGTGGAAAGGTCCAGCTCGGTCGGCCCGACCCCCAAACACGTACATTCGGCTGCCGATTACCGTGGCAGAGTGGAAATCTCTCCAGCGGGCAGCATTGCCCTTGGCTCTCACTAAGGCCCAGTCCATGGATCGCGTGTCCGAGTTTATGGATTTCATTGGGAGAAACAGTCGGCCCGCTGCCTCATATTCACCCAAATATTTTACATTTGTCCTCTTCATAAAAACCCCGGGCGGGA
Full Trace Sequence: ACGCGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCCGTGCGAGGACAGCAGGGGCCGGCTAATATTACTGTTTGTTGTCATTGCTGAGAGCTCCCATCTGATGTCATGGGGCAGACACGACTGGTCAAGATTGTGGTGCAGCACGGCTAGTTTGCACAGTGTCTTCAGACTGGGACTGAAGTCCAGGATATACAGGTCAGAATGATCCATCAAATAAAACTCGTCCTGCAGGTCCTGATCCTGGGAAGGGCTTGTGCCACCAAAAAGAAGGATTTTGTCCCCAACAACACAACAGCACTGCCTGCGCCGTGCACATGGCCCCTTCCCTTGGACTTCTACTCGCTGCCATCGGCCTGACTCTGGTGTGAATTTCCAAAGGTCTTGAAAGTGGCGATTAAGTCGAGCATTGTATCCGCCGAACACATAGAGCTCCCCCTGGTACGCAAAGGCTGAGTGGCTGCGTCTCCCCTCGGGGGGATTGGTGCTCTCAGGAGGGTCCAGCCAAGTCTCAATCTGGAGGTCAAACACACGAATCTGATTGCAGTAAATCTCATTGTTGGAGTGGAAAGGTCCAGCTCGGTCGGCCCGACCCCCAAACACGTACATTCGGCTGCCGATTACCGTGGCAGAGTGGAAATCTCTCCAGCGGGCAGCATTGCCCTTGGCTCTCACTAAGGCCCAGTCCATGGATCGCGTGTCCGAGTTTATGGATTTCATTGGGAGAAACAGTCGGCCCGCTGCCTCATATTCACCCAAATATTTTACATTTGTCCTCTTCATAAAAACCCCGGGCGGGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCCGTGCGAGGACAGCAG