ORFeome > klhdc4 ORF1 – XORFeome v1.0

klhdc4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: klhdc4
Gene ID: 987968
Gene Page ID: 987962
ORF Xenbase ID: 17281515

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043978
Original XGC clone length: 1737

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11016
Well Location: D02

Sequences - 5ʹ (forward) EST

Accession: JZ824292
dbEST ID: 79641994
Trimmed Sequence: ATGGGGAAGAAAGGGAAAAAAGAGAAAAAGGTGAAAGGCGCAGAGAAAACAGCTGCCAAGATGGAAAAGAAAGTGTCTAAAAGGTCCAAAAAAGATGAGGAGGATTTGGAAGCTCTCATAGCTGAATTTCAAACACTTGATGCTAAGAAGACCCAGATTATAGAAACCATCTGTCCTCCACCTTCCCCAAGGTTAAATGGATCCCTCAGCCCACACCCAGAAAAAGATGAGTTGATTCTCTTTGGAGGTGAATATTTCAATGGACAAAAAACTTTTCTCTACAATGAGCTGTACATATATAACATCAAAAAGAATGCATGGAGCAAGATAGACATTCCAAACCCTCCTCCACGAAGATGTGCTCATCAGGCTGTGGCTGTTCCACAGGGTGGAGGGCAACTTTGGATTTTTGGAGGAGAGTTTGCATCACCTGATGGGGAGCAGTTTTACCACTATAAGGATCTGTGGGTTCTGCACCTTCAGACCAAGACTTGGGAAAAGATCAAGGCATCTGGTGGACCATCTGGGAGAAGTGGCCATCGCATGACGTACTGCAAAAGGCAGCTGATTGTTTTTGGAGGATTTCATGAGAGCACAAGGGACTACATCTATTATAATGACGTGTACACCTTTAATCTTGACTCCTTCACATGGGCTAAACTTTCACCCTCTGGAACTGCTCCACTGCCTCGATCTGGATGTCAGATGATCACCAATCAGGGATGGAAGTGTGGTCATTTATTGGAAGATATTTCTATCTTAGAGTCAAGAATGGATGTTTGACAAAGGAAGCAATACCACCCGGACCTGTTTTTCTGTTTTGAACCAAGGAG
Full Trace Sequence: CCTTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGGAAGAAAGGGAAAAAAGAGAAAAAGGTGAAAGGCGCAGAGAAAACAGCTGCCAAGATGGAAAAGAAAGTGTCTAAAAGGTCCAAAAAAGATGAGGAGGATTTGGAAGCTCTCATAGCTGAATTTCAAACACTTGATGCTAAGAAGACCCAGATTATAGAAACCATCTGTCCTCCACCTTCCCCAAGGTTAAATGGATCCCTCAGCCCACACCCAGAAAAAGATGAGTTGATTCTCTTTGGAGGTGAATATTTCAATGGACAAAAAACTTTTCTCTACAATGAGCTGTACATATATAACATCAAAAAGAATGCATGGAGCAAGATAGACATTCCAAACCCTCCTCCACGAAGATGTGCTCATCAGGCTGTGGCTGTTCCACAGGGTGGAGGGCAACTTTGGATTTTTGGAGGAGAGTTTGCATCACCTGATGGGGAGCAGTTTTACCACTATAAGGATCTGTGGGTTCTGCACCTTCAGACCAAGACTTGGGAAAAGATCAAGGCATCTGGTGGACCATCTGGGAGAAGTGGCCATCGCATGACGTACTGCAAAAGGCAGCTGATTGTTTTTGGAGGATTTCATGAGAGCACAAGGGACTACATCTATTATAATGACGTGTACACCTTTAATCTTGACTCCTTCACATGGGCTAAACTTTCACCCTCTGGAACTGCTCCACTGCCTCGATCTGGATGTCAGATGATCACCAATCAGGGATGGAAGTGTGGTCATTTATTGGAAGATATTTCTATCTTAGAGTCAAGAATGGATGTTTGACAAAGGAAGCAATACCACCCGGACCTGTTTTTCTGTTTTGAACCAAGGAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGAAGAAAGGGAAAAAAG

Sequences - 3ʹ (reverse) EST

Accession: JZ829635
dbEST ID: 79647337
Trimmed Sequence: GTCCTTTAATTCATAAAATGTCTTCGCCATAGCCTGTGCAACTTTTAGAACTTTCTTTTCCTTTGCGTCAGGGCCCATGTTAGTGCGAGCAAGTTTAATCCAGTATTCCTCAGTCCGAGCCAAGTAGTCTGGATATTTCTCTTGTGACTCTACTGGAGGGTGTGAATCTTCATCACTTTCCTCACTATCTTCCTCCTCCTCCTCCTCCTCATCTCCTCCTCCTTCTACACCCTCAGCCTCTTCATCTTCAGAATCTGACTCATCAAGCCATTCTTGTGCTTTTGGATCTATTTCCACTAGGACCTTCCACTCTTCCATTTTATGTAAGTCAAGACTGTACAGGTCATTTAGTGTAAATTGACGGTCACCAACTTCAAACATCCCACCATATGCATAAAGAACCCCTTGTTTGACAGCTATCATGGTATTGGAACGTGGACAAGGTTCCACAGCTGGACTTCTAGCTCCTTCTTCTTCTTCTTCCTCAACAGAGTCCTCCTCTTCACTCTCCAAAGCTGATGGGGCCGATATCACTTGTTTGATTGTCATCACTGTCCCATCTTCTGCAATAATTTCTTTTATAACTTCTATAGGCCCTGTTGGGTTTTGTGCGCCAACCTCCCCATTCTCTGATGGTGATGCTGTTTCAGATTGCTTATTTCCACGCCGGCCGTTTCTTTCTTTCTGTTTTTCGGTCCCTTAATCTGGACCAGCCAAACCAACGGTTCTTCCCCCAAAAACAAACAGGTAAAATGTTCCATTTAAAAAATTCTCCCT
Full Trace Sequence: CAGCGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCCTTTAATTCATAAAATGTCTTCGCCATAGCCTGTGCAACTTTTAGAACTTTCTTTTCCTTTGCGTCAGGGCCCATGTTAGTGCGAGCAAGTTTAATCCAGTATTCCTCAGTCCGAGCCAAGTAGTCTGGATATTTCTCTTGTGACTCTACTGGAGGGTGTGAATCTTCATCACTTTCCTCACTATCTTCCTCCTCCTCCTCCTCCTCATCTCCTCCTCCTTCTACACCCTCAGCCTCTTCATCTTCAGAATCTGACTCATCAAGCCATTCTTGTGCTTTTGGATCTATTTCCACTAGGACCTTCCACTCTTCCATTTTATGTAAGTCAAGACTGTACAGGTCATTTAGTGTAAATTGACGGTCACCAACTTCAAACATCCCACCATATGCATAAAGAACCCCTTGTTTGACAGCTATCATGGTATTGGAACGTGGACAAGGTTCCACAGCTGGACTTCTAGCTCCTTCTTCTTCTTCTTCCTCAACAGAGTCCTCCTCTTCACTCTCCAAAGCTGATGGGGCCGATATCACTTGTTTGATTGTCATCACTGTCCCATCTTCTGCAATAATTTCTTTTATAACTTCTATAGGCCCTGTTGGGTTTTGTGCGCCAACCTCCCCATTCTCTGATGGTGATGCTGTTTCAGATTGCTTATTTCCACGCCGGCCGTTTCTTTCTTTCTGTTTTTCGGTCCCTTAATCTGGACCAGCCAAACCAACGGTTCTTCCCCCAAAAACAAACAGGTAAAATGTTCCATTTAAAAAATTCTCCCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCCTTTAATTCATAAAATGTCT