ORFeome > klhl32 ORF1 – XORFeome v1.0

klhl32 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: klhl32
Gene ID: 5858972
Gene Page ID: 5858955
ORF Xenbase ID: 17281587

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124970
Original XGC clone length: 1863

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: B02

Sequences - 5ʹ (forward) EST

Accession: JZ837400
dbEST ID: 79655102
Trimmed Sequence: ATGCCATCTGAGATATGCCTCAGTGTTCAAGAAATGCTGACAGGTCAGAGGCACTGCCAATCAATATCTCACAAAGATGCTGTCCTGTCTGCTCTGAACCAGCAGAGAAACGATGGAATTTTATGTGATATTACACTTGTTGCTGAAGAACAAAAATTCCATGCTCACAAGGCAGTGCTGGCAGCATGCAGTGATTACTTCCGTGCTATGTTTAGTTTGTGTATGGTAGAAAGTGAAGCTGATGAGGTCAACTTGCATGGAGTCACCAGTCTTGGTTTGAAACAAGCCCTGGATTTCGCCTACACTGGACAGATTCTTTTGGAGCCTGGAGCAATCCAAGATGTGTTGGCTGCTGGGAGTCACCTCCAGTTGCTGGAGCTTTTAAACCTGTGTTCTCAGTACCTCATCCAGGAATTAAATAGCTTTAACTACCTGGATCTGTATAAGCTGGCCGACCTGTTTAACCTAACTTTACTAGAGACTGCAGTGGTGGAATTTCTTGTTAAACATCTGTCACAGCTTTTAAAAAATCACCCTGAAGAAGTTCTGCCACTACCTTTTCGACTTCTCCTACACGTTTTAAAGATTGACCAATTAGCTTCAATGAATGAAGAACAGATATAACAACTGGCTGTCAGATGTCTGGAGCGGGAGTGGCCTTATCGGTACATGAATGAGCAATGGAAATATGTTTCGTTTTGGCCTTTGGGTAGGGAAAAGAAATTCAACCATTTGCTTCTTCCTATCCTTTTATTCTATCCTTTTTATACTGAGAAAGAATTAAATACAACAAAACCCTTTGGAAATACCACCGGAAAG
Full Trace Sequence: CGAGGCACCAAATAATAGATTTTATTTNTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCATCTGAGATATGCCTCAGTGTTCAAGAAATGCTGACAGGTCAGAGGCACTGCCAATCAATATCTCACAAAGATGCTGTCCTGTCTGCTCTGAACCAGCAGAGAAACGATGGAATTTTATGTGATATTACACTTGTTGCTGAAGAACAAAAATTCCATGCTCACAAGGCAGTGCTGGCAGCATGCAGTGATTACTTCCGTGCTATGTTTAGTTTGTGTATGGTAGAAAGTGAAGCTGATGAGGTCAACTTGCATGGAGTCACCAGTCTTGGTTTGAAACAAGCCCTGGATTTCGCCTACACTGGACAGATTCTTTTGGAGCCTGGAGCAATCCAAGATGTGTTGGCTGCTGGGAGTCACCTCCAGTTGCTGGAGCTTTTAAACCTGTGTTCTCAGTACCTCATCCAGGAATTAAATAGCTTTAACTACCTGGATCTGTATAAGCTGGCCGACCTGTTTAACCTAACTTTACTAGAGACTGCAGTGGTGGAATTTCTTGTTAAACATCTGTCACAGCTTTTAAAAAATCACCCTGAAGAAGTTCTGCCACTACCTTTTCGACTTCTCCTACACGTTTTAAAGATTGACCAATTAGCTTCAATGAATGAAGAACAGATATAACAACTGGCTGTCAGATGTCTGGAGCGGGAGTGGCCTTATCGGTACATGAATGAGCAATGGAAATATGTTTCGTTTTGGCCTTTGGGTAGGGAAAAGAAATTCAACCATTTGCTTCTTCCTATCCTTTTATTCTATCCTTTTTATACTGAGAAAGAATTAAATACAACAAAACCCTTTGGAAATACCACCGGAAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCATCTGAGATATGCC

Sequences - 3ʹ (reverse) EST

Accession: JZ837399
dbEST ID: 79655101
Trimmed Sequence: CATTGTGCCCATCCGATGGTGAGGAACTTGCAAAGTCTGCAGATTGGGGCAAGTGAAGTAGGGGGCGGGCAGAAAACTTGCTGCTATACCATTGGAAGCAAAGGGTAATGTCGGACCATAGAACACCTCCTCTTTGCCTTCTCTGCTAACATCCAGAACCTGTATGCACGCCAAAGGTTCATTTGTCCAAATTGAATAACCGCCCACTAAATAAATTCTTCCATTATACACAGCAACTCCAGATTCATTTTGGCCTGTAAGTAGATTGAAGTTGCAGCGAGTCCATTGATCAGTGTCAATATTGTAGGAATCAATGTGCCGTACCAGAATGCGATCATTATTGTAATCCAGATCATTTCCCCCAAGCACATACAGCTTCCTCTGTACAGCCGCCATTGCGTGATATACTCTCCTTTGCAGCATTGGACTACGGCTTATCCATTTATTCTGGATTGGGTCATATACCATTAATCTGTTCTGATATTGTGCTGTGTTCGTCACGCCACCTGATATCCACAGTAGGCCATCAGCAACACATCCGGCATGACAGGAAAGGGATCGGTCAAAGGACTGTACAAAAGTCCACTTATTCTTCTTTGGGCAGTATCGTTCCACTTGAGGTAAACATTGCCGCAATTTCATTCTACCACCCAACTGCATAAAGGAAATTCACCTAATGCTCCCCAACACCAAAATTGCTCCTCTTGCGATTTTTTTCCTTTGAAACCA
Full Trace Sequence: GGGCAAACCGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATTGTGCCCATCCGATGGTGAGGAACTTGCAAAGTCTGCAGATTGGGGCAAGTGAAGTAGGGGGCGGGCAGAAAACTTGCTGCTATACCATTGGAAGCAAAGGGTAATGTCGGACCATAGAACACCTCCTCTTTGCCTTCTCTGCTAACATCCAGAACCTGTATGCACGCCAAAGGTTCATTTGTCCAAATTGAATAACCGCCCACTAAATAAATTCTTCCATTATACACAGCAACTCCAGATTCATTTTGGCCTGTAAGTAGATTGAAGTTGCAGCGAGTCCATTGATCAGTGTCAATATTGTAGGAATCAATGTGCCGTACCAGAATGCGATCATTATTGTAATCCAGATCATTTCCCCCAAGCACATACAGCTTCCTCTGTACAGCCGCCATTGCGTGATATACTCTCCTTTGCAGCATTGGACTACGGCTTATCCATTTATTCTGGATTGGGTCATATACCATTAATCTGTTCTGATATTGTGCTGTGTTCGTCACGCCACCTGATATCCACAGTAGGCCATCAGCAACACATCCGGCATGACAGGAAAGGGATCGGTCAAAGGACTGTACAAAAGTCCACTTATTCTTCTTTGGGCAGTATCGTTCCACTTGAGGTAAACATTGCCGCAATTTCATTCTACCACCCAACTGCATAAAGGAAATTCACCTAATGCTCCCCAACACCAAAATTGCTCCTCTTGCGATTTTTTTCCTTTGAAACCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATTGTGCCCATCCGATGGT