ORFeome > klhl41 ORF1 – XORFeome v1.0

klhl41 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: klhl41
Gene ID: 5850545
Gene Page ID: 5850463
ORF Xenbase ID: 17281599

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129525
Original XGC clone length: 1821

Human orthology & disease relationships

NCBI Entrez ID: 10324
Ensembl gene IDs: ENSG00000239474
Directly associated (OMIM) disease MIM numbers: 615731
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: D02

Sequences - 5ʹ (forward) EST

Accession: JZ837860
dbEST ID: 79655562
Trimmed Sequence: ATGGATCCCACTGGGGAAATGAAGGATGAACTCAGGCTTTACCAGTCGACTCTTCTTCAGGATGGCCTGAAGGAACTTCTTGATGAAAATAAATTTGTAGATTGCTTCTTAAAGGCTGGTGACAAAAGCCTCCCATGCCACAGGCTGATCCTTGCTGCCTGCAGCCCTTATTTCCGGGAGTTCTTCCTATCTGATGAAGCTGAGGAGAAGAAGAAAAATGTGGAATTAGACAATATCGACCCAAGCACAATGGAAGCCATCCTTAAATATCTCTATTCTGCTGATATTGACCTTAATGACAGCAATGTGCAAGATATTTTTGCTTTGGCCAGTCGCTACCATGGCCCATCTNTTTTCNCNNTGNTNTNACTTATCTTCNAANANNNCTTTCTCCCTCCNNTTCNCCCNCTTTCTTTNACTTNCNTCTTCNCCTTTTCTNNCTNCCTTTTTTCTTCCCCNCTTTCTTTTNCTNTCTTTNCTTTTCTCNTACNCCTTTCCTTNTCNNTTTTTTTCCCCNCNNCCTTTCCCTTCTCTTTCTTTTTTNCTTCTTTTTTTTCCCTCCCTCTCCTCTCCCCCTTTCCTTTCTCNTCTTCCCTTTTCCTCTCTTTTTCCCTCCCCCCTCTTTCCCCTTTTCTCTTTTCTCCTTTTTTCCCCTCNNCNTCCTCTTCTTTTCCTTTTTTTTCCTCCNTCCTNTTCTCTTTTCTTTCCNTTTTTTTTNTNCNTCCTCCCCCCCCNNCCTCTTTCCCTTNTTTTNTTTTTTTTCAAAAAAAAAAAAAAAAATAAATTAACNNATTAANTTATANANACNTTCNCCTATANNNTAANN
Full Trace Sequence: GCTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATCCCACTGGGGAAATGAAGGATGAACTCAGGCTTTACCAGTCGACTCTTCTTCAGGATGGCCTGAAGGAACTTCTTGATGAAAATAAATTTGTAGATTGCTTCTTAAAGGCTGGTGACAAAAGCCTCCCATGCCACAGGCTGATCCTTGCTGCCTGCAGCCCTTATTTCCGGGAGTTCTTCCTATCTGATGAAGCTGAGGAGAAGAAGAAAAATGTGGAATTAGACAATATCGACCCAAGCACAATGGAAGCCATCCTTAAATATCTCTATTCTGCTGATATTGACCTTAATGACAGCAATGTGCAAGATATTTTTGCTTTGGCCAGTCGCTACCATGGCCCATCTNTTTTCNCNNTGNTNTNACTTATCTTCNAANANNNCTTTCTCCCTCCNNTTCNCCCNCTTTCTTTNACTTNCNTCTTCNCCTTTTCTNNCTNCCTTTTTTCTTCCCCNCTTTCTTTTNCTNTCTTTNCTTTTCTCNTACNCCTTTCCTTNTCNNTTTTTTTCCCCNCNNCCTTTCCCTTCTCTTTCTTTTTTNCTTCTTTTTTTTCCCTCCCTCTCCTCTCCCCCTTTCCTTTCTCNTCTTCCCTTTTCCTCTCTTTTTCCCTCCCCCCTCTTTCCCCTTTTCTCTTTTCTCCTTTTTTCCCCTCNNCNTCCTCTTCTTTTCCTTTTTTTTCCTCCNTCCTNTTCTCTTTTCTTTCCNTTTTTTTTNTNCNTCCTCCCCCCCCNNCCTCTTTCCCTTNTTTTNTTTTTTTTCAAAAAAAAAAAAAAAAATAAATTAACNNATTAANTTATANANACNTTCNCCTATANNNTAANN
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATCCCACTGGGGAA

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGGGCAGGGAAACAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTNACTGATANTGACCTGTTCNTTNCAACAAATTNATAANCAATGCTTTCTTATAATGCCAACTTTNTACAAAAAANTTNNCAACAACTTANTCANTTTNAAAANNTTAACACACATNTCTAAACAANTCCCTCAATTNAAATAACAAATCCCTCTCTNAAAATAATTCACACACACTNTCAAAACACAATAAATTTTCTATCTACTAAACAAACCTAAAATATCTTCCACATTACTCTCATTAANNTCACTATCAACAAAAACAANATATTAAAANATCCCTTCAATTNTTCTTCCCTCNACATTATCTAATTCCACATTTTTCTTCTTCTCCTCAACTTCATCAAATAAAAAAAACTCCCTNAAATAAACTCTCCCATCAACAAATATAAAACAATATCATNACANACTTTTATCACCANCCTTTAAAAAACAATCTACAAATTTATTTTCATCAAAAAATTCCTTCAANCCATCCTAAAAAAAAATCAATCTTTAAAACCTAACTTCATCCTTCATTTCCCCACTAAAATCAATNNTCCCAACTTTTTTTTAACAAATTNNCATTAAAAAAAAACCTTTCTCCTCANTTTTTTTCAAAAAAAANTCACTATCANTCAANTAAAATCCTTANTTNANNNCCNANNNNANNANNNAAAAAAAAAAAAAAAAANNNNNNNNNNNNNNNNNNAAAAANANANAAAAAACAAACAAAANAANNNNNNNNNNNAAAAAAAAAAAAAAAAAAANNNNNNNNNAAAAAAAAAAANANNNANNNNANNNNNNNNNNNNNNNNNANNNNNNAANNAANAAAAAAAAAAAAAAAAANANNNNNNNNNNNNNNNNNNNANNNAAANAAAAAAAAAAANAAAANAAAAAAANNNNNNNANANNAANNANAAAANAAANNNNNNNNNNNNNNNNNNNAANNNNNAANNNNNNNNNNNNNAAAANAAAAAAAAAAAAAAANANNANNNNNNNNNANNANNNNNNANAAAAAAAAAAAAAAAAAAAANNANANNNNNNNNNNANNNNANNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNANNNNNNNNNNNNNNNANNNANNNNNNAANNNNNNNNNNNNNNNNNNANNNNNNANNNNNNNNNNNAAANNANAAANNNNNNNNNNNNNNANNNNAANNNANNNNANNNANNNNNAAANNNNAAANNNNNNNNNNNNANNANNANNNNNNNNNNNNNAAANNANNNNNNNNNNNNNNNNNNNNNNN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAACTTAGTCAGTTTGAAAAGGTT