ORFeome > knstrn ORF1 – XORFeome v1.0

knstrn ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: knstrn
Gene ID: 6486033
Gene Page ID: 974811
ORF Xenbase ID: 17281623

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124995
Original XGC clone length: 729

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: G11

Sequences - 5ʹ (forward) EST

Accession: JZ837541
dbEST ID: 79655243
Trimmed Sequence: ATGGAAAAATCCAAAATTCCTGTTCCCAAGTCCCAAGGAGTACATAATACAGAAAAACCACACGTCAGTGAACAAAGTGTACCATGTCCCAAAAAGCCTTGTCCTCAGAAACCCACTCTGCCTCTTTACAGCAAGGATCCAAACATCGTATTCTCAGTCAGCGCGCCCGATGTTGGAGTGTTCAAAGCAGTCGGCCATGGGAAAAAAACCCTTGCTTCTAAGAAACCTTCTGCTCCAACCCGCGGTATCACAACTCGCTACAGGATGGAAGCAGAATTGCGAGACCGAAACCAGCTTTTGGAAGCAGCCAATGTCAGCTTGCATGCCAACCTGACTAACGCACAGGGTACCATTAAAGAGATGACTGAACGTCAAGTAGTGCTGGAAAATGATCTCAAAGAGTTAAACCGGCGGTTAGAAAAAAATTTGATTATCCTTGAAAACCGAAATATTGATCCTGTTTCAGGGGAAGAAATCCTGGCATCTGCTGAAGAAACCAGCAAGTTAAGATCAGAAACAAAGCTCTTCACAGAAAATCTTTTAGATGAATTGCAGAATTTCAGCGAAGCAACCAGCGAGCAAAGAACCCTTATGCAGACTGTTATGGCAAAATGGAAGGAAGCAGACAAAGGAAGAAATCAATTTTGTGGATAAGCAGAAAAGCACTTGAAAGAGAACTTGAAAATTTCCGGGAAAGCTTACTGGAGGCAGAAAAGCAACCTGGAAGGGGTTGCCCAGGTTTCCTGAACAAAGTTG
Full Trace Sequence: CGAGGGCCTATATAANTGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAAAATCCAAAATTCCTGTTCCCAAGTCCCAAGGAGTACATAATACAGAAAAACCACACGTCAGTGAACAAAGTGTACCATGTCCCAAAAAGCCTTGTCCTCAGAAACCCACTCTGCCTCTTTACAGCAAGGATCCAAACATCGTATTCTCAGTCAGCGCGCCCGATGTTGGAGTGTTCAAAGCAGTCGGCCATGGGAAAAAAACCCTTGCTTCTAAGAAACCTTCTGCTCCAACCCGCGGTATCACAACTCGCTACAGGATGGAAGCAGAATTGCGAGACCGAAACCAGCTTTTGGAAGCAGCCAATGTCAGCTTGCATGCCAACCTGACTAACGCACAGGGTACCATTAAAGAGATGACTGAACGTCAAGTAGTGCTGGAAAATGATCTCAAAGAGTTAAACCGGCGGTTAGAAAAAAATTTGATTATCCTTGAAAACCGAAATATTGATCCTGTTTCAGGGGAAGAAATCCTGGCATCTGCTGAAGAAACCAGCAAGTTAAGATCAGAAACAAAGCTCTTCACAGAAAATCTTTTAGATGAATTGCAGAATTTCAGCGAAGCAACCAGCGAGCAAAGAACCCTTATGCAGACTGTTATGGCAAAATGGAAGGAAGCAGACAAAGGAAGAAATCAATTTTGTGGATAAGCAGAAAAGCACTTGAAAGAGAACTTGAAAATTTCCGGGAAAGCTTACTGGAGGCAGAAAAGCAACCTGGAAGGGGTTGCCCAGGTTTCCTGAACAAAGTTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAAAATCCAAAATTCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ837540
dbEST ID: 79655242
Trimmed Sequence: CACATTCAGCTGCTTCTCTGCCTGCAGTAAGCATTCCCGGAACTGTTCAAGTTCTCTCTCAAGTGCTTTCTGCTCATCCACAAATTGATTTCTTCCTTTGTCTGCTTCCTTCCATTTTGCCATAACAGTCTGCATAAGGGTTCTTTGCTCGCTGGTTGCTTCGCTGAAATTCTGCAATTCATTTAAAAGATTTTCTGTGAAGAGCTTTGTTTCTGATCTTAACTTGCTGGTTTCTTCAGCAGATGCCAGGATTTCTTCCCCTGAAACAGGATCAATATTTCGGTTTTCAAGGATAATCAAATTTTTTTCTAACCGCCGGTTTAACTCTTTGAGATCATTTTCCAGCACTACTTGACGTTCAGTCATCTCTTTAATGGTACCCTGTGCGTTAGTCAGGTTGGGAGGGAAGCTGACATTGGCTGCTTCGAAAAGCTGGTTTCGTTCTCGCAATTCTGCTTCCATCCTATCACGAGTTGTGAAACCGCCCGGTTGGAGGGGAAGGATTCGTATAAACAAGGGTTGGTTGCCTTGGCCGGGGGGTTTGAGGAAAGAGGGTCGGGGCGGGGTGGGGGAAAAAAAAAAATAAATACCGTATATAACAAAAGGAAGAGGGTATCGAAGCACAAAAGGGGGGGGGGACATGGGGGGGGGGACGGCTGCCACCGGGGGGGTGTGGGGGGGGTTGTGGACTTCCGGGGAGCCGTTTCCAAAGGAGGGAAAGAGGAAATTTATAGTAGTGTATACGCCAG
Full Trace Sequence: GGGGAAACAGCTATGGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACATTCAGCTGCTTCTCTGCCTGCAGTAAGCATTCCCGGAACTGTTCAAGTTCTCTCTCAAGTGCTTTCTGCTCATCCACAAATTGATTTCTTCCTTTGTCTGCTTCCTTCCATTTTGCCATAACAGTCTGCATAAGGGTTCTTTGCTCGCTGGTTGCTTCGCTGAAATTCTGCAATTCATTTAAAAGATTTTCTGTGAAGAGCTTTGTTTCTGATCTTAACTTGCTGGTTTCTTCAGCAGATGCCAGGATTTCTTCCCCTGAAACAGGATCAATATTTCGGTTTTCAAGGATAATCAAATTTTTTTCTAACCGCCGGTTTAACTCTTTGAGATCATTTTCCAGCACTACTTGACGTTCAGTCATCTCTTTAATGGTACCCTGTGCGTTAGTCAGGTTGGGAGGGAAGCTGACATTGGCTGCTTCGAAAAGCTGGTTTCGTTCTCGCAATTCTGCTTCCATCCTATCACGAGTTGTGAAACCGCCCGGTTGGAGGGGAAGGATTCGTATAAACAAGGGTTGGTTGCCTTGGCCGGGGGGTTTGAGGAAAGAGGGTCGGGGCGGGGTGGGGGAAAAAAAAAAATAAATACCGTATATAACAAAAGGAAGAGGGTATCGAAGCACAAAAGGGGGGGGGGACATGGGGGGGGGGACGGCTGCCACCGGGGGGGTGTGGGGGGGGTTGTGGACTTCCGGGGAGCCGTTTCCAAAGGAGGGAAAGAGGAAATTTATAGTAGTGTATACGCCAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACATTCAGCTGCTTCTC