ORFeome > kpna2 ORF1 – XORFeome v1.0

kpna2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: kpna2
Gene ID: 979802
Gene Page ID: 979795
ORF Xenbase ID: 17281635

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC046373
Original XGC clone length: 1581

Human orthology & disease relationships

NCBI Entrez ID: 3838
Ensembl gene IDs: ENSG00000182481
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 114500,132600,133239,151623,155255,211980,260500,275355,603278

Library Location

Plate ID: GDExl11012
Well Location: D08

Sequences - 5ʹ (forward) EST

Accession: JZ823982
dbEST ID: 79641684
Trimmed Sequence: ATGTCCAACAATGAGAATGGTGCCCGTCTCACTAGGTTCAAGAACAAGGGCAAGGACTCCACGGAAATGAGGAGGAGGAGGATTGAGGTGAACGTGGAGCTGCGTAAGGCCAAGAAAGATGATCAGATGCTAAAGAGGAGAAATGTCAGCACCTTCCCAGATGAGCCAACCTCTCCCCTCCAGGAGAAGAACCAGAATGGGCAGACCTCTTCACAGTGGAGTGTTGAGGAGATTGTCCGAGGTGTCGCCAACCCTAGCCTGGACATACAGCTACAGGCCACACAGGCTGCAAGGAAACTTTTGTCCAGAGAGCGTGAGCCACCAATTGACCGCATCATTAAGGCTGGTCTCATTCCCAAGCTGGTAACTTTTCTGGCCCACTCTGACTGCAGCCCCATTCAGTTTGAGGCTGCCTGGGCTTTGACGAACATTGCTTCTGGAACTTCTGATCAAACCAAGGCTGTTGTTGAAGGCGGTGGTGTCCCGGCCTTCATCTCTCTTTTGGCATCTCCTCATCCTCACATCAGCGAGCAGGCTGTGTGGGCCTTGGGAAACATTGCAGGTGATGGATCTGCTTACAGAGATCTGGTTATTAAACATGGAGCTGTTGGGCCTCTGTTAGCTTTATTGGCTGGTCCTGACCTCTCCACATTAGCTACTGGTTACCTCAGAAACGTTACATGGACTCTTTCAAACTTGTGCCCGCACAAGATCCAGCCCCACCGCTGGATGCCATTCAGCAGATCTTGCCCACAATAGGTGAGACTACTGCATCATGAATAAACAAAAAGGTACCGG
Full Trace Sequence: AATATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCAACAATGAGAATGGTGCCCGTCTCACTAGGTTCAAGAACAAGGGCAAGGACTCCACGGAAATGAGGAGGAGGAGGATTGAGGTGAACGTGGAGCTGCGTAAGGCCAAGAAAGATGATCAGATGCTAAAGAGGAGAAATGTCAGCACCTTCCCAGATGAGCCAACCTCTCCCCTCCAGGAGAAGAACCAGAATGGGCAGACCTCTTCACAGTGGAGTGTTGAGGAGATTGTCCGAGGTGTCGCCAACCCTAGCCTGGACATACAGCTACAGGCCACACAGGCTGCAAGGAAACTTTTGTCCAGAGAGCGTGAGCCACCAATTGACCGCATCATTAAGGCTGGTCTCATTCCCAAGCTGGTAACTTTTCTGGCCCACTCTGACTGCAGCCCCATTCAGTTTGAGGCTGCCTGGGCTTTGACGAACATTGCTTCTGGAACTTCTGATCAAACCAAGGCTGTTGTTGAAGGCGGTGGTGTCCCGGCCTTCATCTCTCTTTTGGCATCTCCTCATCCTCACATCAGCGAGCAGGCTGTGTGGGCCTTGGGAAACATTGCAGGTGATGGATCTGCTTACAGAGATCTGGTTATTAAACATGGAGCTGTTGGGCCTCTGTTAGCTTTATTGGCTGGTCCTGACCTCTCCACATTAGCTACTGGTTACCTCAGAAACGTTACATGGACTCTTTCAAACTTGTGCCCGCACAAGATCCAGCCCCACCGCTGGATGCCATTCAGCAGATCTTGCCCACAATAGGTGAGACTACTGCATCATGAATAAACAAAAAGGTACCGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCAACAATGAGAATGGTG

Sequences - 3ʹ (reverse) EST

Accession: JZ829290
dbEST ID: 79646992
Trimmed Sequence: GAAGTTAAATGTAGTGTGAGTTCCACCTTCCACCTGGAAAGCATAGCCGTCGGCTGTGGTCTCAGGAGCCAATGATTCATCTTCTCCATCCTCTGCAGAGAAGTATTTCTCAATGAGAGCAGCCGATGCTTTGTAAACCTGCTCATTCTCATGAGATTGCAAAGCCTCAATGCGGTCAAGACCACCACATTCCTCTACCATTAGGCACAGCTTCTCAGTTTCCCCAATCTTATCAGCAGCAGCAAATATATTGGTGAATGCATCTAGCATGACCAGCACAGTCTTGCTGTCCTTGACTGACAGGAGATTTGACAGAGGCTCGATGATACCACATTGGACGAGGTAGATAATTTGATCTATTGTTCCCCCACTTGTGTAGTTTGTGACTGCCCAAATAGCTTCTTTCTGGGTCTTGTAGTCACCCTTCCTAAGGATTTCAACGAGGTAGGGAATTAGCCCACAATTGACCACTTCCTGGATCTGGTCCTGACGCCCAGCAGTAATGTTGGACAATGTCCAGGCAGCTTCCTTCTGGATGTTATTCTTGTGGTGCGTGAGCAGCTCAATAAAGGCAGATAAAGCCCCAGCGTCAAGAACAACTTGGGTCTGCTCATCTGTGCCAGTCACAAATGTTCCCAATAATTCTCAAACAAGGGGGTCACAACGGGCAACTCTTCACAGGCCAATAGCCTGGACAATGGCGAAAAAACTAAACCTGGGGCGGAACCCCCCCCTTCCAAATCCGGTCCATTTTTGAACCCAT
Full Trace Sequence: GGACAGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAAGTTAAATGTAGTGTGAGTTCCACCTTCCACCTGGAAAGCATAGCCGTCGGCTGTGGTCTCAGGAGCCAATGATTCATCTTCTCCATCCTCTGCAGAGAAGTATTTCTCAATGAGAGCAGCCGATGCTTTGTAAACCTGCTCATTCTCATGAGATTGCAAAGCCTCAATGCGGTCAAGACCACCACATTCCTCTACCATTAGGCACAGCTTCTCAGTTTCCCCAATCTTATCAGCAGCAGCAAATATATTGGTGAATGCATCTAGCATGACCAGCACAGTCTTGCTGTCCTTGACTGACAGGAGATTTGACAGAGGCTCGATGATACCACATTGGACGAGGTAGATAATTTGATCTATTGTTCCCCCACTTGTGTAGTTTGTGACTGCCCAAATAGCTTCTTTCTGGGTCTTGTAGTCACCCTTCCTAAGGATTTCAACGAGGTAGGGAATTAGCCCACAATTGACCACTTCCTGGATCTGGTCCTGACGCCCAGCAGTAATGTTGGACAATGTCCAGGCAGCTTCCTTCTGGATGTTATTCTTGTGGTGCGTGAGCAGCTCAATAAAGGCAGATAAAGCCCCAGCGTCAAGAACAACTTGGGTCTGCTCATCTGTGCCAGTCACAAATGTTCCCAATAATTCTCAAACAAGGGGGTCACAACGGGCAACTCTTCACAGGCCAATAGCCTGGACAATGGCGAAAAAACTAAACCTGGGGCGGAACCCCCCCCTTCCAAATCCGGTCCATTTTTGAACCCAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAGTTAAATGTAGTGTGAGTTCC