ORFeome > kpna2-prov ORF1 – XORFeome v1.0

kpna2-prov ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6256583
Gene Page ID:
ORF Xenbase ID: 17281641

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043778
Original XGC clone length: 1581

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11012
Well Location: B01

Sequences - 5ʹ (forward) EST

Accession: JZ823907
dbEST ID: 79641609
Trimmed Sequence: ATGTCCAGCAATGAGAATGGTGCCCGCCTCACCAGGTTCAAAAACAAGGGCAAGGACTCCACGGAAATGAGGAGGCGGAGGATTGAAGTGAACGTGGAGCTGCGCAAGGCCAAGAAAGATGATCAGTTGCTAAAGAGGAGAAATGTCAGCACCTTCCCAGATGAGCCAACCTCTCCCCTACAGGAGAAGAACCAGAATGGGCAGACCTCTACACAGTGGAGTGTTGAAGAGATTGTCCGAGGTGTCTCCAGCCCTAACCTAGACATTCAGCTACAGGCCACGCAGGCTGCAAGGAAGCTTTTGTCCAGAGAGCGGGAGCCTCCAATTGATCGCATCATTCAGGCTGGTCTCATTCCCAAGCTGGTAGCCTTCCTGGCCCATTCGGACTGCAGCCCCATTCAGTTTGAGGCTGCCTGGGCTTTGACAAACATCGCGTCTGGAACCTCTGATCAAACCAAGGCTGTTGTGGAAGGGTGGTGGGGTCCCAGCCTTCATATCCCTTTTGGCATCTCCTCATCCTCACATCAGTGAGCAGGCAGTGTGGGCCTTGGGAAACATTGCAGGTGATGGATCTGCTTACCGAGATCTAGTTATTAAACATGGAGCTGTTGGGCCTCTGCTAGCCTTATTGGCTGGTCCTGACCTCTCCACACTAGCTACTGGCTACCTCAGAAATGTTACATGGACCCTCTCAAACCTGTGTCGCAACAAGAACCCAGCCCCACCCTCTGGATGCAATTCAGCAGATCTTGCCCAACCTAATTGAGAATGGTGCATCATGAAGGAACCGGGAGGGTACTGGCTTAGAACCTGGCTGGGGGCGG
Full Trace Sequence: CAATAGTGAATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCAGCAATGAGAATGGTGCCCGCCTCACCAGGTTCAAAAACAAGGGCAAGGACTCCACGGAAATGAGGAGGCGGAGGATTGAAGTGAACGTGGAGCTGCGCAAGGCCAAGAAAGATGATCAGTTGCTAAAGAGGAGAAATGTCAGCACCTTCCCAGATGAGCCAACCTCTCCCCTACAGGAGAAGAACCAGAATGGGCAGACCTCTACACAGTGGAGTGTTGAAGAGATTGTCCGAGGTGTCTCCAGCCCTAACCTAGACATTCAGCTACAGGCCACGCAGGCTGCAAGGAAGCTTTTGTCCAGAGAGCGGGAGCCTCCAATTGATCGCATCATTCAGGCTGGTCTCATTCCCAAGCTGGTAGCCTTCCTGGCCCATTCGGACTGCAGCCCCATTCAGTTTGAGGCTGCCTGGGCTTTGACAAACATCGCGTCTGGAACCTCTGATCAAACCAAGGCTGTTGTGGAAGGGTGGTGGGGTCCCAGCCTTCATATCCCTTTTGGCATCTCCTCATCCTCACATCAGTGAGCAGGCAGTGTGGGCCTTGGGAAACATTGCAGGTGATGGATCTGCTTACCGAGATCTAGTTATTAAACATGGAGCTGTTGGGCCTCTGCTAGCCTTATTGGCTGGTCCTGACCTCTCCACACTAGCTACTGGCTACCTCAGAAATGTTACATGGACCCTCTCAAACCTGTGTCGCAACAAGAACCCAGCCCCACCCTCTGGATGCAATTCAGCAGATCTTGCCCAACCTAATTGAGAATGGTGCATCATGAAGGAACCGGGAGGGTACTGGCTTAGAACCTGGCTGGGGGCGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCAGCAATGAGAATGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ829216
dbEST ID: 79646918
Trimmed Sequence: GAAGTCAAACGTGGTGTGAGTTCCACCTTCCACCTGGAAAGTATAGCCGTCGGCTGTGGTCTCAGGAGCCAGAGATTCATCTTCTCCATCCTCTGCAGAGAAGTATTTCTCAATGAGACCAGCCGATGCTTTGTAGACCTGCTCATTCTCATGAGACTGCAGAGCCTCGATACGGTCGAGACCACCACATTCCTCTACCATTAGGCACAGTTTCTCTGTCTCCCCAAGCTTATCAGCAGCAGCGAATATATTGGTGAAGGCATCTAGAATGACCAGCACAGTCTTGCTGTCCTTGACAGACAAGAGATTTGACAGAGGCTCAATGACACCACATTGGACGAGGTAGATAATCTGATCTATTGTTCCCCCACTTGTGTAGTTTGTGACTGCCCAAATCGCTTCTTTTTGAGTCTTGTAGTCACCCTTCCTGAGAATTTCAATGAGGTAGGGCATTAACCCATGATTGACTACTTCCTGGATCTGGTCCTGACGCCCAGCAGTAATGTTGGACAGTGTCCAGGCAGCTTCTTTCTGGATATTATTTCTGTGGTGGGTGAGCAGCTCCGCAAAGACAGACAAAGCCTCAGCATCAAGAAACCACTGGGTTTGCTCATCTGTACCAGTCACAATGGTTCCCATGGGTTCTCA
Full Trace Sequence: CGTGGCAGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAAGTCAAACGTGGTGTGAGTTCCACCTTCCACCTGGAAAGTATAGCCGTCGGCTGTGGTCTCAGGAGCCAGAGATTCATCTTCTCCATCCTCTGCAGAGAAGTATTTCTCAATGAGACCAGCCGATGCTTTGTAGACCTGCTCATTCTCATGAGACTGCAGAGCCTCGATACGGTCGAGACCACCACATTCCTCTACCATTAGGCACAGTTTCTCTGTCTCCCCAAGCTTATCAGCAGCAGCGAATATATTGGTGAAGGCATCTAGAATGACCAGCACAGTCTTGCTGTCCTTGACAGACAAGAGATTTGACAGAGGCTCAATGACACCACATTGGACGAGGTAGATAATCTGATCTATTGTTCCCCCACTTGTGTAGTTTGTGACTGCCCAAATCGCTTCTTTTTGAGTCTTGTAGTCACCCTTCCTGAGAATTTCAATGAGGTAGGGCATTAACCCATGATTGACTACTTCCTGGATCTGGTCCTGACGCCCAGCAGTAATGTTGGACAGTGTCCAGGCAGCTTCTTTCTGGATATTATTTCTGTGGTGGGTGAGCAGCTCCGCAAAGACAGACAAAGCCTCAGCATCAAGAAACCACTGGGTTTGCTCATCTGTACCAGTCACAATGGTTCCCATGGGTTCTCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAGTCAAACGTGGTGTGAG