ORFeome > krt18 ORF1 – XORFeome v1.0

krt18 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: krt18
Gene ID: 6256523
Gene Page ID: 5820466
ORF Xenbase ID: 17281713

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054993
Original XGC clone length: 1299

Human orthology & disease relationships

NCBI Entrez ID: 3875
Ensembl gene IDs: ENSG00000111057
Directly associated (OMIM) disease MIM numbers: 215600
Indirectly associated (Lage, et al.) disease MIM numbers: 101600,104300,105120,108120,115200,123320,123500,131950,145980,182290,184500,192600,215600,226650,226670,601419,604765,606072,607801,607841,608758,609285

Library Location

Plate ID: GDExl11003
Well Location: F02

Sequences - 5ʹ (forward) EST

Accession: JZ839455
dbEST ID: 79657157
Trimmed Sequence: ATGAGTTACTCTCGCTCTATGTACTCTTCCTCCTCTGTGGTAGGTGGGAGTCCCTACCGCTCCCTGAGCTCAGCACCCCGTTTTGCACCAGGTAGCAGCGCTGCAAGCGTCCATGCAGGTCCAGGGGGTTCTGGTGCCCGGATCTCTGTATCTAGGGTATCCTCCGTGGGATCAGGGTTTGGTGGTGGATTTAGTGGTGGATTTAGTGGGGTATCTAATGTCAGTCTGATGGGTGGGGCCCAGAATGAGAAGGAGACCATGCAGGACCTGAATGACCGTCTGGCATCTTACCTGGAAAGAGTCCGCAGCCTGGAGACAGCCAATAAGGAACTGGAGGTGCAAATTCGTCAGCACACTGAAAAGAAGGGGCCTGCCAAGGACTGGAGTCCATACTACAAGGCTATTGAGGACTTAAAAAAACAGGTGTTTGATAGCACAGTAGACAACTCCCAGCTGGTTCTGCAGATTGACAACGCTCGCCTCGCAGCTGACGACTTCAGAGTGAAGTATGAAGCTGAATTGGCTATCCGTATGTCTGTGGAAACCGACATTGGTGGGCTGCGCAAGCTTATAGATGATACCAACATCAGCAGATTGAACCTGGAGAATGAGATTGAGTCACTGAAAGAGGAACTGATCTTCCTGAATAAAAACCACAAGATGATGTGAATGACCTCCAGGCTCACATTGCACGCTCTGCAGTCCCTGGTGAAAGTGGAGGCCCCCGAATCCCAAGACCTTTGGCAAAATCTGGGCGAAACTTCGGGAACAGATAGAATGGAATTGCCACAAAAAACCCGTAAAAAAGTTTAAAAAATGGTTTTCAGTTCCAAAGGT
Full Trace Sequence: GACCCCAAATAATAGGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTTACTCTCGCTCTATGTACTCTTCCTCCTCTGTGGTAGGTGGGAGTCCCTACCGCTCCCTGAGCTCAGCACCCCGTTTTGCACCAGGTAGCAGCGCTGCAAGCGTCCATGCAGGTCCAGGGGGTTCTGGTGCCCGGATCTCTGTATCTAGGGTATCCTCCGTGGGATCAGGGTTTGGTGGTGGATTTAGTGGTGGATTTAGTGGGGTATCTAATGTCAGTCTGATGGGTGGGGCCCAGAATGAGAAGGAGACCATGCAGGACCTGAATGACCGTCTGGCATCTTACCTGGAAAGAGTCCGCAGCCTGGAGACAGCCAATAAGGAACTGGAGGTGCAAATTCGTCAGCACACTGAAAAGAAGGGGCCTGCCAAGGACTGGAGTCCATACTACAAGGCTATTGAGGACTTAAAAAAACAGGTGTTTGATAGCACAGTAGACAACTCCCAGCTGGTTCTGCAGATTGACAACGCTCGCCTCGCAGCTGACGACTTCAGAGTGAAGTATGAAGCTGAATTGGCTATCCGTATGTCTGTGGAAACCGACATTGGTGGGCTGCGCAAGCTTATAGATGATACCAACATCAGCAGATTGAACCTGGAGAATGAGATTGAGTCACTGAAAGAGGAACTGATCTTCCTGAATAAAAACCACAAGATGATGTGAATGACCTCCAGGCTCACATTGCACGCTCTGCAGTCCCTGGTGAAAGTGGAGGCCCCCGAATCCCAAGACCTTTGGCAAAATCTGGGCGAAACTTCGGGAACAGATAGAATGGAATTGCCACAAAAAACCCGTAAAAAAGTTTAAAAAATGGTTTTCAGTTCCAAAGGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTTACTCTCGCTCTATG

Sequences - 3ʹ (reverse) EST

Accession: JZ839454
dbEST ID: 79657156
Trimmed Sequence: AGCCTTGAGGACTTCAGTATCATTGCTTTCTGCAACCACCTTCCCATCCACAATCCTCTGTGTGGTCGTGATCACTTTCTTTACCGTCTGTGTGGTTACTGTTGGTACAGCATCCTGGAGATCAAAGCTATCTCCTTCCAGGAGCCTTCTGTAGGTATGGATTTCTGCTTCCAGCTTCATCTTTGTGTTAAGAAGAGCCTGGTACTCCTGTTGTTGCCTCTGGCAGTCACTGCGGACTTGTACCAACTCTGACTCCCGTGCCATGGCAGTGCCACCAAGCATTTCCAGTTCCATTGCATAACGTGCCTCTGTGTCGTGGAGTGTGCCCTCTAAGCTGGCTTTCTGGTTGCGCAGTGACTCCAGCTCTATTTCTAGGGACTGCATAGTGCGGCGCAGTTCAGTGACGGAATTCTTTGAAGTCTGCAGTTCTTGTGTGTCTATGTTAACTTGCATGGTGTGCTCCTCCACCTTTGACTGATACCACTTTTCAACATCTTCACGGTTCTTTTGTGCCAGTCCATCATACTGTGCCCGAAGTTCTGCCATGATTTTGCCAAGGTCTTGTGATTTTGGGGCATCCACCTCCACAGTGACTGCAGAGCGTGCAATCTGAGCCTGGAGTTCTTCACATCATCCCTGGTGGTTCTTCCTTAGGAGAATCACCTCCTCCTTCCAGTGATTCAATCCTAATCCTCCAGGGTCAATCCTGCTGAAGTTGGTTATCACCCATAAGGCCTTGGGCAAGCCCGCCCAATGTTTGGGGTTTTCCCAAGAAAG
Full Trace Sequence: AAAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGCCTTGAGGACTTCAGTATCATTGCTTTCTGCAACCACCTTCCCATCCACAATCCTCTGTGTGGTCGTGATCACTTTCTTTACCGTCTGTGTGGTTACTGTTGGTACAGCATCCTGGAGATCAAAGCTATCTCCTTCCAGGAGCCTTCTGTAGGTATGGATTTCTGCTTCCAGCTTCATCTTTGTGTTAAGAAGAGCCTGGTACTCCTGTTGTTGCCTCTGGCAGTCACTGCGGACTTGTACCAACTCTGACTCCCGTGCCATGGCAGTGCCACCAAGCATTTCCAGTTCCATTGCATAACGTGCCTCTGTGTCGTGGAGTGTGCCCTCTAAGCTGGCTTTCTGGTTGCGCAGTGACTCCAGCTCTATTTCTAGGGACTGCATAGTGCGGCGCAGTTCAGTGACGGAATTCTTTGAAGTCTGCAGTTCTTGTGTGTCTATGTTAACTTGCATGGTGTGCTCCTCCACCTTTGACTGATACCACTTTTCAACATCTTCACGGTTCTTTTGTGCCAGTCCATCATACTGTGCCCGAAGTTCTGCCATGATTTTGCCAAGGTCTTGTGATTTTGGGGCATCCACCTCCACAGTGACTGCAGAGCGTGCAATCTGAGCCTGGAGTTCTTCACATCATCCCTGGTGGTTCTTCCTTAGGAGAATCACCTCCTCCTTCCAGTGATTCAATCCTAATCCTCCAGGGTCAATCCTGCTGAAGTTGGTTATCACCCATAAGGCCTTGGGCAAGCCCGCCCAATGTTTGGGGTTTTCCCAAGAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGCCTTGAGGACTTCAGTATCATT