ORFeome > krt5.6 ORF1 – XORFeome v1.0

krt5.6 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: krt5.6
Gene ID: 6488853
Gene Page ID: 919654
ORF Xenbase ID: 17281743

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC129698
Original XGC clone length: 1776

Human orthology & disease relationships

NCBI Entrez ID: 3852
Ensembl gene IDs: ENSG00000186081
Directly associated (OMIM) disease MIM numbers: 131760,131800,131900,131960,179850,601001,609352
Indirectly associated (Lage, et al.) disease MIM numbers: 131760,131800,131900,131960,179850,609040,609352

Library Location

Plate ID: GDExl11091
Well Location: B06

Sequences - 5ʹ (forward) EST

Accession: JZ838625
dbEST ID: 79656327
Trimmed Sequence: ATGAGTCAGTATAAGCAGTTTAGTGTTCGATCAGTAGCAACTTCAGGCAAACCTGGCTTCAGTTCATTTTCCGTGGCTAAGAGTGGTGGAGGTTTTGGAGGTGCTTCAGGAGGAGGTAGTTTTGGTAGCAGAAGTCTTTACAATGTAGGGTCTAGAAAGATCAGTTCCGTTAGTTCTGCAAGTGGAGGTGGCTATGGAAGTGCAGCAGGTGGTTTTGGTGGAAGAGTCAGTGGTTTTGGTGGCGGAGTATGTGGGGGAGCCTTTGGAGGAACTGGTGGTGCCCTTGTAGGAGCAGGTGGTGCTGTTTTGAGGAGAAGGTGTTGCATGAATTCTTCGAGTTACATCAGTTTTCTGTATGATGACCTTGTTCAACATCGGAGCCTTGTTGTCCTTGCTTTTTTCGGGGGATTCACTCTTCTCGAACAAATGTGGTCCTTGACCATCTGCTCATGGGCCTCCCGGACCGCAGGGATGGACGGACCGTCGGCATTACTAGATCCGCCGTTGGGGCCGCAATGTTGGAAGAGAAATCCACTTGGCACACGTCTTTCGGCTCTGCTTCCGTTCCGTACTTAATAGCTGGAGGATGGGGAAATGTTGTTGTGAAGATTTTATTATTTAGGATTTAAGGCGGGGGGGGACATGGGGGGGGGGGACACAAAGAATACTCCCTCTTTGTGGGGGGGGGGGAGAAAAAACCCCCCCGC
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTCAGTATAAGCAGTTTAGTGTTCGATCAGTAGCAACTTCAGGCAAACCTGGCTTCAGTTCATTTTCCGTGGCTAAGAGTGGTGGAGGTTTTGGAGGTGCTTCAGGAGGAGGTAGTTTTGGTAGCAGAAGTCTTTACAATGTAGGGTCTAGAAAGATCAGTTCCGTTAGTTCTGCAAGTGGAGGTGGCTATGGAAGTGCAGCAGGTGGTTTTGGTGGAAGAGTCAGTGGTTTTGGTGGCGGAGTATGTGGGGGAGCCTTTGGAGGAACTGGTGGTGCCCTTGTAGGAGCAGGTGGTGCTGTTTTGAGGAGAAGGTGTTGCATGAATTCTTCGAGTTACATCAGTTTTCTGTATGATGACCTTGTTCAACATCGGAGCCTTGTTGTCCTTGCTTTTTTCGGGGGATTCACTCTTCTCGAACAAATGTGGTCCTTGACCATCTGCTCATGGGCCTCCCGGACCGCAGGGATGGACGGACCGTCGGCATTACTAGATCCGCCGTTGGGGCCGCAATGTTGGAAGAGAAATCCACTTGGCACACGTCTTTCGGCTCTGCTTCCGTTCCGTACTTAATAGCTGGAGGATGGGGAAATGTTGTTGTGAAGATTTTATTATTTAGGATTTAAGGCGGGGGGGGACATGGGGGGGGGGGACACAAAGAATACTCCCTCTTTGTGGGGGGGGGGGAGAAAAAACCCCCCCGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTCAGTATAAGCAGTTTAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838624
dbEST ID: 79656326
Trimmed Sequence: ACTCCTGTAGCTGGACTGACTCGATGAAAACCTCCCACTGCTGACGCCACCACCAAATGAGGAGCTTGAGGAGCTGAATCCTCCACCTCCTGAGCCAAAGGAAATACCACTGCCACCAAAGGCAGCACCACCACTTCCACCGTAGGCACCACCACTTCCACCGTAGGCACCGCCACTACTTCCACCGAAGGCACCGCCACCACTTCCACCGAAGGCACCACCACCACTTCCAAAGCCGAAGCCTGCTCCTCCTCCTCCTCCTCCTAGGGAACTTTTGCCACCGGAGCTAATGACAGAAATGCTGACATTATTGACATCTGAATTAAGCCTGAATTCTTCGCCTTCCAGCAGTTTTCTGTAAGTAGCAATTTCAACATCCAGAGCCAGTTTCACATTCATCAGTTCCTGGTATTCGCGCAGCTGGAGAGCCATGTCCTGCTTGGCCTTCTGCAGAGCGGCTTCCAGGTCAGCAAGTTTGGACTGAGCATCTTTCAGTACAAGATCCCCACGTTCCTCTGCTTCAGTAATAGATACTTGCAGCTTGGCGATCTGTTTCTTCACATTTTCAATTTCAGCTTTTAGTCTCTGGGATTTACGGTTGAGCTCTGAGATCTCATTCTTTGTATTGCGCAGGACATCCCCTTGTTCACCTGCAGATGCTTGCAACTCTTGAA
Full Trace Sequence: GCGGAAACAGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGNCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACTCCTGTAGCTGGACTGACTCGATGAAAACCTCCCACTGCTGACGCCACCACCAAATGAGGAGCTTGAGGAGCTGAATCCTCCACCTCCTGAGCCAAAGGAAATACCACTGCCACCAAAGGCAGCACCACCACTTCCACCGTAGGCACCACCACTTCCACCGTAGGCACCGCCACTACTTCCACCGAAGGCACCGCCACCACTTCCACCGAAGGCACCACCACCACTTCCAAAGCCGAAGCCTGCTCCTCCTCCTCCTCCTCCTAGGGAACTTTTGCCACCGGAGCTAATGACAGAAATGCTGACATTATTGACATCTGAATTAAGCCTGAATTCTTCGCCTTCCAGCAGTTTTCTGTAAGTAGCAATTTCAACATCCAGAGCCAGTTTCACATTCATCAGTTCCTGGTATTCGCGCAGCTGGAGAGCCATGTCCTGCTTGGCCTTCTGCAGAGCGGCTTCCAGGTCAGCAAGTTTGGACTGAGCATCTTTCAGTACAAGATCCCCACGTTCCTCTGCTTCAGTAATAGATACTTGCAGCTTGGCGATCTGTTTCTTCACATTTTCAATTTCAGCTTTTAGTCTCTGGGATTTACGGTTGAGCTCTGAGATCTCATTCTTTGTATTGCGCAGGACATCCCCTTGTTCACCTGCAGATGCTTGCAACTCTTGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACTCCTGTAGCTGGACTG