ORFeome > krtcap2 ORF1 – XORFeome v1.0

krtcap2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: krtcap2
Gene ID: 6253937
Gene Page ID: 6456308
ORF Xenbase ID: 17281755

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC141754
Original XGC clone length: 411

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: B08

Sequences - 5ʹ (forward) EST

Accession: JZ838839
dbEST ID: 79656541
Trimmed Sequence: ATGGCAGTCAGTACCGGCATCTCCCTGGCCCTCTCCTCCCTGGTGTCCCTCCTGCTATTCGCTGGGATGCAGATGTACAACAAGCAACTGGCCTCATCCGAGTGGCTCACTATCCTGGGGGGACTGCTGGGCTCCGGCATCTTCTTCTTCTCGCTCATTGCGTTCAGTAACCTGGAGAACATGGTGTTTGGGAAGGGCTTCCAGGCCAAGATCTTCCCTGAAGTGGCCGTGTGTCTGTTTGTCGCTCTCTTCGCCTCGGGACTGGTGCACAGGGTGTGTGTGACGACTTGCTTCATCTTCTCACTGGTGGATCTGTATTACGTGAACAAGATCTCGTCGGGTCTGTATCAGAGCTCCCAGCCGACGGTCACCCCCGGGAAGGTGCCAGGAAAGGGCAAGAAGAGAAGCTT
Full Trace Sequence: GGGCTCTAGGTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGTCAGTACCGGCATCTCCCTGGCCCTCTCCTCCCTGGTGTCCCTCCTGCTATTCGCTGGGATGCAGATGTACAACAAGCAACTGGCCTCATCCGAGTGGCTCACTATCCTGGGGGGACTGCTGGGCTCCGGCATCTTCTTCTTCTCGCTCATTGCGTTCAGTAACCTGGAGAACATGGTGTTTGGGAAGGGCTTCCAGGCCAAGATCTTCCCTGAAGTGGCCGTGTGTCTGTTTGTCGCTCTCTTCGCCTCGGGACTGGTGCACAGGGTGTGTGTGACGACTTGCTTCATCTTCTCACTGGTGGATCTGTATTACGTGAACAAGATCTCGTCGGGTCTGTATCAGAGCTCCCAGCCGACGGTCACCCCCGGGAAGGTGCCAGGAAAGGGCAAGAAGAGAAGCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATATTGAGTCGTATTACATGGTCATAGCTGTTGAAAGAAAGCTCCGGCCCGTGTCTCCNGTTCTCTGGTGTTTCAGNNNNNNGNNNNNNNGGGCCGGCCGNNGNNCGGGCCCNGGTTTTNGGGTNGGTNNGCNGGGAACAGAAAAAAAGAAANANANTTGGTGAAATCATTTTAGATGTTTAATAAATGAANGNATAGANANNNNNCGNNNNGTGTTNNNAAGTTNGTNTANNNNNNNGGGGAAANNNNNNCTGNNNNGGTTNNTNGGAAATGTNAGGAGTNT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGTCAGTACCGGCATC

Sequences - 3ʹ (reverse) EST

Accession: JZ838838
dbEST ID: 79656540
Trimmed Sequence: GCTTCTCTTCTTGCCCTTTCCTGGCACCTTCCCGGGGGTGACCGTCGGCTGGGAGCTCTGATACAGACCCGACGAGATCTTGTTCACGTAATACAGATCCACCAGTGAGAAGATGAAGCAAGTCGTCACACACACCCTGTGCACCAGTCCCGAGGCGAAGAGAGCGACAAACAGACACACGGCCACTTCAGGGAAGATCTTGGCCTGGAAGCCCTTCCCAAACACCATGTTCTCCAGGTTACTGAACGCAATGAGCGAGAAGAAGAAGATGCCGGAGCCCAGCAGTCCCCCCAGGATAGTGAGCCACTCGGATGAGGCCAGTTGCTTGTTGTACATCTGCATCCCAGCGAATAGCACGAGGGACACCAGGGAGGAGAGGGCCAGGGAGATGCCGGTACTGACTGCCATGG
Full Trace Sequence: GGGAAACTGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCTTCTCTTCTTGCCCTTTCCTGGCACCTTCCCGGGGGTGACCGTCGGCTGGGAGCTCTGATACAGACCCGACGAGATCTTGTTCACGTAATACAGATCCACCAGTGAGAAGATGAAGCAAGTCGTCACACACACCCTGTGCACCAGTCCCGAGGCGAAGAGAGCGACAAACAGACACACGGCCACTTCAGGGAAGATCTTGGCCTGGAAGCCCTTCCCAAACACCATGTTCTCCAGGTTACTGAACGCAATGAGCGAGAAGAAGAAGATGCCGGAGCCCAGCAGTCCCCCCAGGATAGTGAGCCACTCGGATGAGGCCAGTTGCTTGTTGTACATCTGCATCCCAGCGAATAGCACGAGGGACACCAGGGAGGAGAGGGCCAGGGAGATGCCGGTACTGACTGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAACATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCCAAATAAAATCATTATTTTGGGCCCGAAGCTAAAAAAAAAAAGTCGTTTTACAACTTCCTTGAACAAGGAAACGNNANNGNNNNNNNGNAAAAAGGCCTTCCGTTTCTCGGGGGGCGAAGTAGAGAAAGAAAAGTAAAAGTGGACAGNGGAGANNGGAAAAAACCAGGGAGGGGGGGCGAGGTGGGGATNATAGGANTTTGTGCGGGGGGGGGANNGCCCGGNNNNACNTAGGGGGTAAGAAAAGGGGGTGGGGGGNNGGGGGGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTTCTCTTCTTGCCCTT