ORFeome > krtcap3 ORF1 – XORFeome v1.0

krtcap3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: krtcap3
Gene ID: 6253440
Gene Page ID: 5847077
ORF Xenbase ID: 17281761

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC125992
Original XGC clone length: 708

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: A10

Sequences - 5ʹ (forward) EST

Accession: JZ837517
dbEST ID: 79655219
Trimmed Sequence: ATGGCGGGTGGAAGAAGTAGTGAGACGCGTCCCTGCGGCTTCGGTCTGGAGAAGGGGCCCCGGCAGCTGATGAGAGCGGGGATCACCCTGATATTTGTGGGACACGTCAACTTTATTCTGGGGGCCATTGTGCACGGGACGGTGCTGAGACACGTGGCGAATCCAGAGAAGAGAGTGAGCCCCGAATACTTCACTGCCAACGTCATCTCTGTGGTGTCGGGGCTCTTGAGCATCTCAGCCGGAATCTGTGCCATCCTGGCGTCCCGCAGCCTCCGCAGAGTCCACATACAATGGGCCCTGCTGGTTCTGTCTCTGCTGAACTCTGTGCTCTCACCCGCCTGCTTTGTGGGTTTGGTCCTCCCTGTGTCACTCACCATTGCTGGTGGGGGGAGGAATCTGATATCTGGGTGGGGGTCCTCGGTTCTTCCTGCCGACGCCCGCTCTGTCATGAGGGGGGACTACTGATGGTTTGATTCGAAAGCGGGCGGTGAAAGAAAGGTGCTAGGTGTTTTGCGTCCTGACTCGGGTCTCCCGGTCAGATAAGGGGGGGTTGGTCGGGTGGGGGGGGGGGGGGTGGGGGTTATTAACAAGGGGAGGGGGGCGGGGGGGGGGGGGGGCTGGCTCTTCCTAAAGGGGAAGGGAACGGGGGAGGGGTGTTAAGAGAGAAAAGGTTTTTAGTGGGGAAGGCGGGGGGGGGGGGCCCCGACGGGCTTATCTGGCGCGGGGGGCGCCGGGGGGGGGGGGGGGGGGGGGTGGGAGGGAGGCGGGGGGTGGGGTATTGTGGGGGGAGGGGGG
Full Trace Sequence: TCGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGGTGGAAGAAGTAGTGAGACGCGTCCCTGCGGCTTCGGTCTGGAGAAGGGGCCCCGGCAGCTGATGAGAGCGGGGATCACCCTGATATTTGTGGGACACGTCAACTTTATTCTGGGGGCCATTGTGCACGGGACGGTGCTGAGACACGTGGCGAATCCAGAGAAGAGAGTGAGCCCCGAATACTTCACTGCCAACGTCATCTCTGTGGTGTCGGGGCTCTTGAGCATCTCAGCCGGAATCTGTGCCATCCTGGCGTCCCGCAGCCTCCGCAGAGTCCACATACAATGGGCCCTGCTGGTTCTGTCTCTGCTGAACTCTGTGCTCTCACCCGCCTGCTTTGTGGGTTTGGTCCTCCCTGTGTCACTCACCATTGCTGGTGGGGGGAGGAATCTGATATCTGGGTGGGGGTCCTCGGTTCTTCCTGCCGACGCCCGCTCTGTCATGAGGGGGGACTACTGATGGTTTGATTCGAAAGCGGGCGGTGAAAGAAAGGTGCTAGGTGTTTTGCGTCCTGACTCGGGTCTCCCGGTCAGATAAGGGGGGGTTGGTCGGGTGGGGGGGGGGGGGGTGGGGGTTATTAACAAGGGGAGGGGGGCGGGGGGGGGGGGGGGCTGGCTCTTCCTAAAGGGGAAGGGAACGGGGGAGGGGTGTTAAGAGAGAAAAGGTTTTTAGTGGGGAAGGCGGGGGGGGGGGGCCCCGACGGGCTTATCTGGCGCGGGGGGCGCCGGGGGGGGGGGGGGGGGGGGGTGGGAGGGAGGCGGGGGGTGGGGTATTGTGGGGGGAGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGGTGGAAGAAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ837516
dbEST ID: 79655218
Trimmed Sequence: TGCCGAGGCCTCAATAAGTTGGTGGGTTTCTGGCCTGGGACCCTCTTCCAATCGCTCCTTCTCAGCCTCCTCCTCCTGCATCCGTTCCCTGAGGTAAGTCTGCCCACACGGGCCAATCCCTCGCAGTATAAAAGCCACCACACAGCACCGAACTGACAGTAGCACCTCAACTGCCGACAGGAACATGGAGGGAAACCAGAGAGCCAGTGTGGTGTCATACATCCGCGTGGTATCAAACGGGCGCTCGTTGCTCATCACCACATAGCGGGTGTCGGCAGGCAGAACCGTGGAGTTGCACCCCGATGTCAGATTCTTCCCCCCATTACCACTGGTGAGTGACGCGGCGAGGACCAAACCAACAAAGCGGGCGGGCTGAGAGCACATAATTCATCAGAGACAGAACCANCAGGGCGGATTGTATGTGGACTCTGCAGAGGTTGCGGGAGGCGCGGATGGCACAGATTCCGGGCTGGAGAGCGTCGGAGCCCCGACACCACAAAGGGGAGGATGTCGGGGGGGGGGTGGGGGGGTGGGGGTCTTCTCTTTAATGGGCACGGGGTCTGGGCGCCGGCGGCGGGCACCGGGGGCCCGGGGGGAAGGGGGTTGAGAGGGGTGGGGGGGCTAGCAGGGAGGGGGGGGGGGGGGGTCGGGGGCTTCGGGGGGGCCGCCCGGGGGGCCCGGGGGCCGGGGGGGGGGGGGGGGGGGGGGGGGAGGGTAGGTCTGACCCCACGCGGAGTGGCGGGGGGGCGGGGTTGGGTTTTATTATTTTGGGGGGGG
Full Trace Sequence: GGGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGCCGAGGCCTCAATAAGTTGGTGGGTTTCTGGCCTGGGACCCTCTTCCAATCGCTCCTTCTCAGCCTCCTCCTCCTGCATCCGTTCCCTGAGGTAAGTCTGCCCACACGGGCCAATCCCTCGCAGTATAAAAGCCACCACACAGCACCGAACTGACAGTAGCACCTCAACTGCCGACAGGAACATGGAGGGAAACCAGAGAGCCAGTGTGGTGTCATACATCCGCGTGGTATCAAACGGGCGCTCGTTGCTCATCACCACATAGCGGGTGTCGGCAGGCAGAACCGTGGAGTTGCACCCCGATGTCAGATTCTTCCCCCCATTACCACTGGTGAGTGACGCGGCGAGGACCAAACCAACAAAGCGGGCGGGCTGAGAGCACATAATTCATCAGAGACAGAACCANCAGGGCGGATTGTATGTGGACTCTGCAGAGGTTGCGGGAGGCGCGGATGGCACAGATTCCGGGCTGGAGAGCGTCGGAGCCCCGACACCACAAAGGGGAGGATGTCGGGGGGGGGGTGGGGGGGTGGGGGTCTTCTCTTTAATGGGCACGGGGTCTGGGCGCCGGCGGCGGGCACCGGGGGCCCGGGGGGAAGGGGGTTGAGAGGGGTGGGGGGGCTAGCAGGGAGGGGGGGGGGGGGGGTCGGGGGCTTCGGGGGGGCCGCCCGGGGGGCCCGGGGGCCGGGGGGGGGGGGGGGGGGGGGGGGGAGGGTAGGTCTGACCCCACGCGGAGTGGCGGGGGGGCGGGGTTGGGTTTTATTATTTTGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCCGAGGCCTCAATAAGT