ORFeome > kti12 ORF1 – XORFeome v1.0

kti12 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: kti12
Gene ID: 5813954
Gene Page ID: 5813862
ORF Xenbase ID: 17281767

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC099247
Original XGC clone length: 828

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: A09

Sequences - 5ʹ (forward) EST

Accession: JZ840172
dbEST ID: 79657874
Trimmed Sequence: ATGCCTCTAATTTTGCTGTGTGGCTTCCCCTGCAGTGGTAAAAGCAGCAGGTCACAAGAGCTGCAGGAACACCTGGAACAGAGTGGGAGGAAGGTTCACATCATTGGAGACCATGTTCTTGGAGTGGACAGGAATGCCGTTTATGCAGACTCCAGAGAAGAGAAAGATTTAAGGGGATCTCTGAGAGCTGCAGTGGAAAGGAAGTTAAATAAAGAAGATGTTGTGATTCTGGATTCACTTAACTATATTAAAGGTTACAGATATGAACTGTTCTGCTTGATTAAGCATGTTCAGACTCCACACTGCCTGATTCATTGTATAACATCCCCTGAGGTCAGCTCCACATGGAACCAGCACAGGGACAAAAATGAGCAATATAATCAAGAAATATTTGATTCCTTAGTGCAGAGATTTGAATTTCCAGATTCCCGCAATCGGTGGGACAGCCCGCTTTTTTCAGTGCATAAAGATGAAAAGCTTCCTCTTGAACAGATCTGCAATGCTATATTCCACAGGAAGGCACCTCCTCCGAACCAGTCAACACAAATGCAACCACTGTCCTCCACAAATTTTCTGCATGAGCTGGACAAGGTGACCCAAGAAGTTGTGACTGCTGTGCTGAGTGCTCAGAAAACAGCATTTCGGGAGATGTCATCATGGTACCTGGAGCCAGTGAAAAAGTGCAGCTACCACGAATCTTGAACATGTCTGAGCTGCGGAGAACCCCCCCAACAATTCCATCGTTTACCTAAATTGGCATCCCAATGAAAAATATCCTCC
Full Trace Sequence: CGCGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCTCTAATTTTGCTGTGTGGCTTCCCCTGCAGTGGTAAAAGCAGCAGGTCACAAGAGCTGCAGGAACACCTGGAACAGAGTGGGAGGAAGGTTCACATCATTGGAGACCATGTTCTTGGAGTGGACAGGAATGCCGTTTATGCAGACTCCAGAGAAGAGAAAGATTTAAGGGGATCTCTGAGAGCTGCAGTGGAAAGGAAGTTAAATAAAGAAGATGTTGTGATTCTGGATTCACTTAACTATATTAAAGGTTACAGATATGAACTGTTCTGCTTGATTAAGCATGTTCAGACTCCACACTGCCTGATTCATTGTATAACATCCCCTGAGGTCAGCTCCACATGGAACCAGCACAGGGACAAAAATGAGCAATATAATCAAGAAATATTTGATTCCTTAGTGCAGAGATTTGAATTTCCAGATTCCCGCAATCGGTGGGACAGCCCGCTTTTTTCAGTGCATAAAGATGAAAAGCTTCCTCTTGAACAGATCTGCAATGCTATATTCCACAGGAAGGCACCTCCTCCGAACCAGTCAACACAAATGCAACCACTGTCCTCCACAAATTTTCTGCATGAGCTGGACAAGGTGACCCAAGAAGTTGTGACTGCTGTGCTGAGTGCTCAGAAAACAGCATTTCGGGAGATGTCATCATGGTACCTGGAGCCAGTGAAAAAGTGCAGCTACCACGAATCTTGAACATGTCTGAGCTGCGGAGAACCCCCCCAACAATTCCATCGTTTACCTAAATTGGCATCCCAATGAAAAATATCCTCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTCTAATTTTGCTGTGTG

Sequences - 3ʹ (reverse) EST

Accession: JZ840171
dbEST ID: 79657873
Trimmed Sequence: TCCGTGGATACTCTGGTTTAAATACTGTACAAACATGTTTGCAAGCTGGGAGATATTCTCATTGGGATGCAATTTAGTGTAACTGATGAACTGTTGGCGGAGTCTCCGCAGCTCAGACATGCTCAAGATTCGTGGTAGCTGCACTTTTTCACTGGCTCCAGGTACCATGATGACATCTCCCGGAATGCTGGTTTTCTGAGCACTCAGCACAGCAGTCACAACTTCTTGGGTCACCTTGTCCAGCTCATGCAGAAAATTTGTGGAGGACAGTGGTTGCATTTGTGTTGACTGGTTCGGAGGAGGTGCCTTCCTGTGGAATATAGCATTGCAGATCTGTTCAAGAGGAAGCTTTTCATCTTTATGCACTGAAAAAAGCGGGCTGTCCCACCGATTGCGGGAATCTGGAAATTCAAATCTCTGCACTAAGGAATCAAATATTTCTTGATTATATTGCTCATTTTTGTCCCTGTGCTGGTTCCATGTGGAGCTGACCTCAGGGGATGTTATACAATGAATCAGGCAATGTGGAGTCTGAAAATGCTAAATCAAGCAAAACAGTTCATATCTGTAACCTTTAATATAATTAAGTAAATCCAAAATCAAAAATCCTTCTTTATTTAACTTCCCTTTTCCCTGCAACTTCTCAAAAAATCCCCTTAAGATCTTTCCTCTTTTCTGGAAATTCGCAAAAACGGCCATTCCGGTTCCACCCCCCAAAAACATGGTTTTTCCCAAGGAAGGGGGAAACC
Full Trace Sequence: GCGTGCATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCCGTGGATACTCTGGTTTAAATACTGTACAAACATGTTTGCAAGCTGGGAGATATTCTCATTGGGATGCAATTTAGTGTAACTGATGAACTGTTGGCGGAGTCTCCGCAGCTCAGACATGCTCAAGATTCGTGGTAGCTGCACTTTTTCACTGGCTCCAGGTACCATGATGACATCTCCCGGAATGCTGGTTTTCTGAGCACTCAGCACAGCAGTCACAACTTCTTGGGTCACCTTGTCCAGCTCATGCAGAAAATTTGTGGAGGACAGTGGTTGCATTTGTGTTGACTGGTTCGGAGGAGGTGCCTTCCTGTGGAATATAGCATTGCAGATCTGTTCAAGAGGAAGCTTTTCATCTTTATGCACTGAAAAAAGCGGGCTGTCCCACCGATTGCGGGAATCTGGAAATTCAAATCTCTGCACTAAGGAATCAAATATTTCTTGATTATATTGCTCATTTTTGTCCCTGTGCTGGTTCCATGTGGAGCTGACCTCAGGGGATGTTATACAATGAATCAGGCAATGTGGAGTCTGAAAATGCTAAATCAAGCAAAACAGTTCATATCTGTAACCTTTAATATAATTAAGTAAATCCAAAATCAAAAATCCTTCTTTATTTAACTTCCCTTTTCCCTGCAACTTCTCAAAAAATCCCCTTAAGATCTTTCCTCTTTTCTGGAAATTCGCAAAAACGGCCATTCCGGTTCCACCCCCCAAAAACATGGTTTTTCCCAAGGAAGGGGGAAACC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCCGTGGATACTCTGGTT