ORFeome > lamtor1 ORF1 – XORFeome v1.0

lamtor1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: lamtor1
Gene ID: 6079175
Gene Page ID: 5879625
ORF Xenbase ID: 17281815

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054238
Original XGC clone length: 489

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: D03

Sequences - 5ʹ (forward) EST

Accession: JZ839433
dbEST ID: 79657135
Trimmed Sequence: ATGGGCTGTTGTTACAGCGGAGAGACCGACACCGGCAAAGGGGATCAGGGAGAGAGGGAACATCTGCTGCCCCAAAACCAATCTCTTCCCAACAATAAACAGAATGGATCAGAACAGAACCCCACAAATAACCCCTCGGCTCGCACTGATGAACAGGCCATGCTCTCCCGCATATTGGCCAAGACCGCGCAGAACATTATTGATGTGTCAGCGGTGGAGTCACAGGGGATGGAGCAGCACGAATGTATGGACAGAGCCCGGCAGTACAGCACGAGGCTGGCAAAACTCAGCAGCAATTTGATGGACTGGAAGAACGTGCCCCCCCTCCCCTCATTGACCTCTCAGCCGCACCAAATACTCGCCAGTGACCCTGTTCCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTT
Full Trace Sequence: TCGAGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGCTGTTGTTACAGCGGAGAGACCGACACCGGCAAAGGGGATCAGGGAGAGAGGGAACATCTGCTGCCCCAAAACCAATCTCTTCCCAACAATAAACAGAATGGATCAGAACAGAACCCCACAAATAACCCCTCGGCTCGCACTGATGAACAGGCCATGCTCTCCCGCATATTGGCCAAGACCGCGCAGAACATTATTGATGTGTCAGCGGTGGAGTCACAGGGGATGGAGCAGCACGAATGTATGGACAGAGCCCGGCAGTACAGCACGAGGCTGGCAAAACTCAGCAGCAATTTGATGGACTGGAAGAACGTGCCCCCCCTCCCCTCATTGACCTCTCAGCCGCACCAAATACTCGCCAGTGACCCTGTTCCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTAAAGTGAGTCGTATTACATGGTCATAGCTGTAAAAAAAAAAAAAAAAAACCATGTCTCAAATCTTCCCCGTTCACAGGCAGAAGAAAAAATTTCCCCAATTTTCGTCCCCCCGGGGGGCGGGGGGTGCTCCCTTGTGGGAGGTGGAGGGGGAACACCCCCGGTGGAAATACTCTCCCTCCCTCAAAAGAGAAAAAAGAAAAAAAAATGAGCCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGCTGTTGTTACAGCGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839432
dbEST ID: 79657134
Trimmed Sequence: CGGGATCCCAAACTGTACAACTAAATCCTCTTTTGCATCCACTCGTATCTGTGAGAGCGCACTGAAGGCGTAAGCAGCGATCTTAGACACCTGCTGTATGTCTGTAAAGGGAACAGGGTCACTGGCGAGTATTTGGTGCGGCTGAGAGGTCAATGAGGGGAGGGGGGGCACGTTCTTCCAGTCCATCAAATTGCTGCTGAGTTTTGCCAGCCTCGTGCTGTACTGCCGGGCTCTGTCCATACATTCGTGCTGCTCCATCCCCTGTGACTCCACCGCTGACACATCAATAATGTTCTGCGCGGTCTTGGCCAATATGCGGGAGAGCATGGCCTGTTCATCAGTGCGAGCCGAGGGGTTATTTGTGGGGTTCTGTTCTGATCCATTCTGTTTATTGTTGGGAAGAGATTGGTTTTGGGGCAGCAGATGTTCCCTCTCTCCCTGATCCCCTTTGCCGGTGTCGGTCTCTCCGCTGTAACAACAGCCCATGG
Full Trace Sequence: GGGGCATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACGGGATCCCAAACTGTACAACTAAATCCTCTTTTGCATCCACTCGTATCTGTGAGAGCGCACTGAAGGCGTAAGCAGCGATCTTAGACACCTGCTGTATGTCTGTAAAGGGAACAGGGTCACTGGCGAGTATTTGGTGCGGCTGAGAGGTCAATGAGGGGAGGGGGGGCACGTTCTTCCAGTCCATCAAATTGCTGCTGAGTTTTGCCAGCCTCGTGCTGTACTGCCGGGCTCTGTCCATACATTCGTGCTGCTCCATCCCCTGTGACTCCACCGCTGACACATCAATAATGTTCTGCGCGGTCTTGGCCAATATGCGGGAGAGCATGGCCTGTTCATCAGTGCGAGCCGAGGGGTTATTTGTGGGGTTCTGTTCTGATCCATTCTGTTTATTGTTGGGAAGAGATTGGTTTTGGGGCAGCAGATGTTCCCTCTCTCCCTGATCCCCTTTGCCGGTGTCGGTCTCTCCGCTGTAACAACAGCCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAAGTCACTATCAATCCAAATAAAATCAAATATAAGAAAAAAAAAACTAATAACTTACCGTCGTTTTACAGAAAAAGGATAAGGTGGGGATTTATCAAACTCAACGGCTTCCAAGGGAAAACGGGGGACTCAAACTTTGTAAGATTTTTGAGAGGGGCAAACCCTTCGTAAAATAAACCCATTTCCCTCCGAAACCAGGAAATAAACATAATAGAGCCACCCCAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACGGGATCCCAAACTGTACAA