ORFeome > lamtor2 ORF1 – XORFeome v1.0

lamtor2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: lamtor2
Gene ID: 992367
Gene Page ID: 992363
ORF Xenbase ID: 17281821

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC082921
Original XGC clone length: 378

Human orthology & disease relationships

NCBI Entrez ID: 28956
Ensembl gene IDs: ENSG00000116586,LRG_81
Directly associated (OMIM) disease MIM numbers: 610798
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: G08

Sequences - 5ʹ (forward) EST

Accession: JZ839894
dbEST ID: 79657596
Trimmed Sequence: ATGTTGCGGCCCAAAGCGCTGACCCAGGTTCTGAGCCAGGCCAACACCGGTGGAGTTCAGAGCACTCTGCTGCTGAACAATGAAGGCTCTCTACTTGCATATTCTGGTTATGGTGACACAGATGCCCGAGTTACAGCTGCTATTGCTAGCAACATATGGGCTGCCTATGATAAGAACGGCCACCAGGCATTCAACGAGGACAATCTTAAACTCATCCTTATGGACTGCATGGAGGGCCGCGTAGCAATCACAAGAGTGTCTAACCTGCTGCTGTGCATGTATGCCAAAGAGACTGTTGGATTTGGAATGCTGAAAGCCAAGGCCCAGGCGCTGGTTTATTACTTGGAAGAACCTCTCAACCAGGTGTCGTCTGCCTT
Full Trace Sequence: TTCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTGCGGCCCAAAGCGCTGACCCAGGTTCTGAGCCAGGCCAACACCGGTGGAGTTCAGAGCACTCTGCTGCTGAACAATGAAGGCTCTCTACTTGCATATTCTGGTTATGGTGACACAGATGCCCGAGTTACAGCTGCTATTGCTAGCAACATATGGGCTGCCTATGATAAGAACGGCCACCAGGCATTCAACGAGGACAATCTTAAACTCATCCTTATGGACTGCATGGAGGGCCGCGTAGCAATCACAAGAGTGTCTAACCTGCTGCTGTGCATGTATGCCAAAGAGACTGTTGGATTTGGAATGCTGAAAGCCAAGGCCCAGGCGCTGGTTTATTACTTGGAAGAACCTCTCAACCAGGTGTCGTCTGCCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAACTGATATCCCCTATAGTGATTCTTATTAATTGGTCATAGCTGTTTCTTGAAAAAAAGAAAAAAAGTATCAAATTTCTTTACATTCAATAATCCCCCGGGGAAAAAAGACCAAGCTTCCCCCAAACACGGGGCCGGGAAAAACCACGGGTAAAGGGAAGAACCCCAACCCCGGCAACACCCCCCGCGGCGTTTAAAATGTTTGAACCACACTTCGCGCCCCAACGGGGGGCAACCGCGGCCACACCACCGGGGGGGGAGGGGGGGGGGGTTTATCTGTGTTTCTTTTTTGTTTTTTTTTTTTTTATCTTCTTTTGTCTTCTGCTTACACAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTGCGGCCCAAAGCGCTGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839893
dbEST ID: 79657595
Trimmed Sequence: GGCAAACAACACCTGGTTGAAAGGTTCTTCCAAGTAATAAACCACCGCCTGGGCCTTGGCTTTCAGCATTCCAAATCCAACAGTCTCTTTGGCATACATGCACAGCACCAGGTTAAACACTCTTGTGATTGCTACCCGGCCCTCCATGCAGTCCATAAGGATGAGTTTAAAATTGTCCTCGTTGAATGCCTGGTGGCCGTTCTTATCATAGGCAGCCCATATGTTGCTAGCAATAGCACCTGTAACTCGGGCATCTGTGTCACCATAACCAAAATATGCAAGTAAAGAGCCTTCATTGTTCAGCAGCAAAGTGCTCTGAACTCCACCGGTGTTGGCCTGGCTCAAAACCTGGGTCAGCGCTTTGGGCCGCAACATGG
Full Trace Sequence: GAGAAAACAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGNCTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGCAAACAACACCTGGTTGAAAGGTTCTTCCAAGTAATAAACCACCGCCTGGGCCTTGGCTTTCAGCATTCCAAATCCAACAGTCTCTTTGGCATACATGCACAGCACCAGGTTAAACACTCTTGTGATTGCTACCCGGCCCTCCATGCAGTCCATAAGGATGAGTTTAAAATTGTCCTCGTTGAATGCCTGGTGGCCGTTCTTATCATAGGCAGCCCATATGTTGCTAGCAATAGCACCTGTAACTCGGGCATCTGTGTCACCATAACCAAAATATGCAAGTAAAGAGCCTTCATTGTTCAGCAGCAAAGTGCTCTGAACTCCACCGGTGTTGGCCTGGCTCAAAACCTGGGTCAGCGCTTTGGGCCGCAACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCGGCCCAACCTAAATACTGGCCATCGTTTACATGCTGGGGACTGAGCTGTTCCTGGCAACAAAGGACAATGTCTCAAATCAACAGAGGTCCCAGTATAAAAAATTGGTGGCGGGATGGCCCCAAAACAAAGGAAAAACCCGGGGGCGTGTTAACTTTTGAAAAAACCCTCGCCTCCGGGCCAAGGGGCAACCCCCTCCCCACCTCTATTGTGGAACGGGCGGGGGGGGGGTTTAGCGAGCTCTTTCCTGTGTTTTAGGGAAAACC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCAGACGACACCTGGTT