ORFeome > lamtor3 ORF1 – XORFeome v1.0

lamtor3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: lamtor3
Gene ID: 6253417
Gene Page ID: 942320
ORF Xenbase ID: 17281833

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056026
Original XGC clone length: 372

Human orthology & disease relationships

NCBI Entrez ID: 8649
Ensembl gene IDs: ENSG00000109270
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 155255,202370,214100,266510,601539

Library Location

Plate ID: GDExl11019
Well Location: C12

Sequences - 5ʹ (forward) EST

Accession: JZ824614
dbEST ID: 79642316
Trimmed Sequence: ATGGCAGAAGAATTACGGAGGTTCCTATACAAGAAGCTAACAAGTGTTGAAGGGCTCCACGCTATTGTTGTGTCAGACAGAGATGGAGTGCCAGTTATTAAAGTTGCCAATGAGAATGCCCCTGAGCAGGCATTGAGACCCGCCTTCCTTTCTACATTTGCACTAGCCACCGACCAGGGCAGTAAACTTGGTCTCTCCAAAAATAAGAGCATCATCTGTTACTACAGCACATACCAGGTTGTCCAGTTTAATCAACTGCCTCTGGTAGTAAGCTTCATAGCCAGCAGCAATGCCAATACAGGGCTAATTCTCAGCTTAGAGAAAGAACTCGGCTCCTTGTTCAAAGAGCTTCGTCAGGCGGTGATCTCTTT
Full Trace Sequence: CAAATATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGAAGAATTACGGAGGTTCCTATACAAGAAGCTAACAAGTGTTGAAGGGCTCCACGCTATTGTTGTGTCAGACAGAGATGGAGTGCCAGTTATTAAAGTTGCCAATGAGAATGCCCCTGAGCAGGCATTGAGACCCGCCTTCCTTTCTACATTTGCACTAGCCACCGACCAGGGCAGTAAACTTGGTCTCTCCAAAAATAAGAGCATCATCTGTTACTACAGCACATACCAGGTTGTCCAGTTTAATCAACTGCCTCTGGTAGTAAGCTTCATAGCCAGCAGCAATGCCAATACAGGGCTAATTCTCAGCTTAGAGAAAGAACTCGGCTCCTTGTTCAAAGAGCTTCGTCAGGCGGTGATCTCTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAATAATAAAAAGGTACAAGGTTTTTTTGTGGGCGTTGCTTTGCCGCCTGTTGTCCCGCTGCTGTCACAAGGAAAAATATACAGACGAGATTTCTTTTCCCCCTTGATTCCCACCAGGATATTCCAATCCGGGAAGCTTAGCCGTATAATTGTTTAGCTCATAGACCTGCATTGGCCTGGATGAACCGGATCATTTGGCCCGGCGCGGGCCCAAAAATCCCCGGCCGGCCCCCCCCAAAAAAAAACAACAACCGGCCCAAAACTTTTAAAAATTGGGGAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGAAGAATTACGGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ829964
dbEST ID: 79647666
Trimmed Sequence: AGAGATCACCGCCTGACGAAGCTCTTTGAACAAGGAGCCGAGTTCTTTCTCTAAGCTGAGAATTAGCCCTGTATTGGCATTGCTGCTGGCTATGAAGCTTACTACCAGAGGCAGTTGATTAAACTGGACAACCTGGTATGTGCTGTAGTAACAGATGATGCTCTTATTTTTGGAGAGACCAAGTTTACTGCCCTGGTCGGTGGCTAGTGCAAATGTAGAAAGGAAGGCGGGTCTCAATGCCTGCTCAGGGGCATTCTCATTGGCAACTTTAATAACTGGCACTCCATCTCTGTCTGACACAACAATAGCGTGGAGCCCTTCAACACTTGTTAGCTTCTTGTATAGGAACCTCCGTAATTCTTCTGCCATGG
Full Trace Sequence: CCGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGAGATCACCGCCTGACGAAGCTCTTTGAACAAGGAGCCGAGTTCTTTCTCTAAGCTGAGAATTAGCCCTGTATTGGCATTGCTGCTGGCTATGAAGCTTACTACCAGAGGCAGTTGATTAAACTGGACAACCTGGTATGTGCTGTAGTAACAGATGATGCTCTTATTTTTGGAGAGACCAAGTTTACTGCCCTGGTCGGTGGCTAGTGCAAATGTAGAAAGGAAGGCGGGTCTCAATGCCTGCTCAGGGGCATTCTCATTGGCAACTTTAATAACTGGCACTCCATCTCTGTCTGACACAACAATAGCGTGGAGCCCTTCAACACTTGTTAGCTTCTTGTATAGGAACCTCCGTAATTCTTCTGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTAAAGACAGGCCGTCGTTTTACACGTAGTAAGACCGGGGGAATTTAATAGCANGCACCGGCTATATCCCGCCTTTATTAAAAGAACACACCCGCCTGATGAATGGCTCATCCGGAAATTCGTTTTGCGATGAACCCCGCTGAGCTGGTGATATGGGGATGGGGGTACTCCTTGCTAACCCGGTTTCCCATGGAGCAAAGCTGAAACGGTTTTCACCGCCCCTTGGAGCTGCATCACCCGGAGCGATTCCCCGGGCCGGTTTTTCACATACATATATTTTGCCAAGAAAGGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGAGATCACCGCCTGACGAA