ORFeome > large ORF1 – XORFeome v1.0

large ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: large
Gene ID: 6256639
Gene Page ID: 6250445
ORF Xenbase ID: 17281881

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108590
Original XGC clone length: 2172

Human orthology & disease relationships

NCBI Entrez ID: 9215
Ensembl gene IDs: ENSG00000133424
Directly associated (OMIM) disease MIM numbers: 608840,613154
Indirectly associated (Lage, et al.) disease MIM numbers: 608840

Library Location

Plate ID: GDExl11087
Well Location: B07

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTTTGCTCCTGCCGCAGAACATCCAAATTCCTGGCCATCACCATAGTGCTGCTGTCGACTGCACCCTGGTTGTACCTGTCTGTGGGGTAGACAGAATATGGTCCCTCTCTGGGGCCGAGGTGACGACCTTTCTCCGTCTCCTCGTTGTTTGGCGTGTACTTGGATACTCGCCCGCGCCAAGCCCACAAGGAAAATAGCAGACTGCGACCTCTCCTAGGTGACCGGAACCAGTTGCCAACATTCTTGTACAAATTTGGCATTATAAGAAAGCATTGATTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAACTGATATCCCCTATAGAGAGTCATATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGAACAATGTCTCTCTTTCTCTGATGTTACAGGCCCTTNCTAAAAGGCGTTAAACCTCGCTTTTTTGCTTCGNGCGTGTCTCTCTTCCGTCGTATTGNTGTGCTTTTTTTGCGCGCGGCTGGCCTTCCCGCGTTGCGTGTGCTAGAAAAAATGCNAGTCGGTCTATCTTGTCCATAATGGGGCTGGGTCCTAAATGAGATTAATATAAAAAACACTTTTTATTGCATAACGTCCATTGCGGGTCTATTCATGCTAAAAAAAAAAAAAAAAATATAAAATATGAATAAAAAAAAAAAAAAACCCGGTCCTGGCTAGAGACTTCTCTGAGAATGCGATTACTGANGCGGTCTAGTGGTAGAGAAAGAAAAGAAAGAAAATAGGGAGAAAAAAAAAAAAAAAAAAAAAAGAAAAAAAACGTAAGCGAGATCAGAACGTAAN
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTTTGCTCCTGCCGCAGT

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: AACTGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGGTTCCGCTCAGCCGGTCGCTGGTTCATTCTCCTATTCGCCTCCTCCGCGTCCCCCACGCCAGTCTCGTCCACCTTCTGGAACTCTGAGTTGGCCAACAAATGCGGGGCTACCGGCCCCACACACTGACCATATTCTATCTCCCCCTCGAACAGGTACAACCCGGTGGCAGCCAACACCAGCAATAACGAGAGGGACAAGAATTTGGATTTACTGCGGCAGGACCAAAACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAACCATTGCTCATCAATTTGTTGCAACTAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAATACTGGAGAACGTTTTCCTCGTCTTGTCTGCGGTTTTCCTGGGGAAACGGACAAATGGTCNNNGTGCGTAAAAAAACAAAAGANGGTTANCGAAAGGGGTATACNTGGGGGGGGAGAAAAGNGGGAACNGGTGAGACAAAAAAAAAAAAGGTTNGAAGAAGAGGAAAAGNGGTNNGNGGGGGGNNNNTGAAAAAGAGAAAGAGAAAAGGGCAAAGNNNANGGAGGGGAGNAAGGGNGNNAGGAAGGNNNNNGNNGAAAAAAAAAAAAAAAGAAGGGNNNNAAAAGAAAAAAAAAAAGAAAAAAAAAANANNNNANNANAANGNAGGANNGANGGANAGANNGGNNNGGNANGGTTNGAAAAAAAGAGANGGTGGAAAGAAAACAAAAAAGAAAAAAAAAAAAGNAAGAAAGGAAAAAAGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGGTTCCGCTCAGCCG