ORFeome > lbr ORF1 – XORFeome v1.0

lbr ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: lbr
Gene ID: 6252399
Gene Page ID: 979299
ORF Xenbase ID: 17281911

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC124994
Original XGC clone length: 1863

Human orthology & disease relationships

NCBI Entrez ID: 3930
Ensembl gene IDs: ENSG00000143815
Directly associated (OMIM) disease MIM numbers: 169400,215140,613471
Indirectly associated (Lage, et al.) disease MIM numbers: 169400,215140

Library Location

Plate ID: GDExl11085
Well Location: D01

Sequences - 5ʹ (forward) EST

Accession: JZ837524
dbEST ID: 79655226
Trimmed Sequence: ATGATTAAGAAAATGCCAGGCCAAAAATATGAGATTGGTGAGACTGTGATGGGTCGGTGGCCAGGAAGCAGCCTTTACTATGAAGTGGCAGTGGGGGGGATTCAATAGCAAGTCTCAGGAATATAAAGTCCTTTATAAAGATGGAACTGATCTGGATCTTAAGGAGGGTGACATTAAGAGACAGAATATCTTCAACCGGAAAAGATCCTCCTCTCCCTCAAGACGCAGGAGTCGATCCAGGTCCCGATCTCCAGGGCGCTCTCGCTCTCCTGCACGTCGCCGTTCCCCTCTGCGTCCAAGTTCTCCAGGACGACCTGCAAAGAATGGACATCAGTCATCTCTAATCCGAGATATCAAAAAAGGGGATACACTTCAAGTGCACCTAACCCCCGTGAAATTGCAGGACTACAGTACCGGCAAACATAATGGTGAACCCGAAGGCTTTGAGAAAATAACTACACGCCACAGAGCAACACCAGTTAAAGCAATAGAGCTGATGGAGGAAGAGTTGGAGAGGAATGAAAAGGTTTTGCATTACAATCTCAGCCCGAAACAGGAGAGCAGCATACCAACAGGGATTGTGCTGGCAGACAGTGTACCGACAGAAACCTTGCAGAAATGACTGAGAAGAATGCTGAAGATTCCAAAACTGCCATTTGGGAGGAACAATCCGGTTGCTTC
Full Trace Sequence: TCGAGGGCCCAATAATTGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATTAAGAAAATGCCAGGCCAAAAATATGAGATTGGTGAGACTGTGATGGGTCGGTGGCCAGGAAGCAGCCTTTACTATGAAGTGGCAGTGGGGGGGATTCAATAGCAAGTCTCAGGAATATAAAGTCCTTTATAAAGATGGAACTGATCTGGATCTTAAGGAGGGTGACATTAAGAGACAGAATATCTTCAACCGGAAAAGATCCTCCTCTCCCTCAAGACGCAGGAGTCGATCCAGGTCCCGATCTCCAGGGCGCTCTCGCTCTCCTGCACGTCGCCGTTCCCCTCTGCGTCCAAGTTCTCCAGGACGACCTGCAAAGAATGGACATCAGTCATCTCTAATCCGAGATATCAAAAAAGGGGATACACTTCAAGTGCACCTAACCCCCGTGAAATTGCAGGACTACAGTACCGGCAAACATAATGGTGAACCCGAAGGCTTTGAGAAAATAACTACACGCCACAGAGCAACACCAGTTAAAGCAATAGAGCTGATGGAGGAAGAGTTGGAGAGGAATGAAAAGGTTTTGCATTACAATCTCAGCCCGAAACAGGAGAGCAGCATACCAACAGGGATTGTGCTGGCAGACAGTGTACCGACAGAAACCTTGCAGAAATGACTGAGAAGAATGCTGAAGATTCCAAAACTGCCATTTGGGAGGAACAATCCGGTTGCTTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATTAAGAAAATGCCAGGCCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837523
dbEST ID: 79655225
Trimmed Sequence: GTAAACATATGGGAGTAAGCGGTAACGCACGTGTTGGCAGTACTTGTCCCAGTCCAGCCCGTATTTCTCTCGGCATCTCTGTTCATCTCTGGCGGCTCGGTCAATTAGAAGTAATGTTAAAAAGATCACGTAGAAATAGGGCAAAATGTGGTTAAAGCCACAGGCCAAACACCAGGCTAAAGCCATTATTATGTCACCCAAGTAATTAGGATGACGGACAAAGCCCCACCATCCAGAGATCAAGAGCTTGCTTCCTGCTGAGGTAGGAATAGTCTTCAGATGGGAAAGTCGCGGATCATCTGGATTCTGCCTGAAGGCGCATTTCTGGTTATTGGCACCTCGGTATATGATGTAACCCAAAAATTTCAAGGCCACAATGGCGGAAGCTGCCTGCCTGGACAAATCCACAGGGTTGTTAACTAAGTAATAAGTCTGTAAGGAATAAGTGAATGGGGCCACTGCCAGGCTTCCAAATGCCAAAAGGAAACCAAATCCATCACGTACAATATCCGGTGACATTAAAAAATATTCCTCATTCCAGAAACCATCAAGCACATACAGCAACTGAAAACTGTTCACCAAGATCATCGATAAAGACGGCTCATCCCATTTGTGTACTTTCATTTTCGCGAAGAGCATGATTAATTTAATAAGAACCCAGCCTCATTAATGCTTGGCCCA
Full Trace Sequence: GGGGAAACTGCTATGAACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTAAACATATGGGAGTAAGCGGTAACGCACGTGTTGGCAGTACTTGTCCCAGTCCAGCCCGTATTTCTCTCGGCATCTCTGTTCATCTCTGGCGGCTCGGTCAATTAGAAGTAATGTTAAAAAGATCACGTAGAAATAGGGCAAAATGTGGTTAAAGCCACAGGCCAAACACCAGGCTAAAGCCATTATTATGTCACCCAAGTAATTAGGATGACGGACAAAGCCCCACCATCCAGAGATCAAGAGCTTGCTTCCTGCTGAGGTAGGAATAGTCTTCAGATGGGAAAGTCGCGGATCATCTGGATTCTGCCTGAAGGCGCATTTCTGGTTATTGGCACCTCGGTATATGATGTAACCCAAAAATTTCAAGGCCACAATGGCGGAAGCTGCCTGCCTGGACAAATCCACAGGGTTGTTAACTAAGTAATAAGTCTGTAAGGAATAAGTGAATGGGGCCACTGCCAGGCTTCCAAATGCCAAAAGGAAACCAAATCCATCACGTACAATATCCGGTGACATTAAAAAATATTCCTCATTCCAGAAACCATCAAGCACATACAGCAACTGAAAACTGTTCACCAAGATCATCGATAAAGACGGCTCATCCCATTTGTGTACTTTCATTTTCGCGAAGAGCATGATTAATTTAATAAGAACCCAGCCTCATTAATGCTTGGCCCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTAAACATATGGGAGTAAGCGG