ORFeome > lck ORF1 – XORFeome v1.0

lck ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: lck
Gene ID: 6054022
Gene Page ID: 6054020
ORF Xenbase ID: 17281923

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129712
Original XGC clone length: 1509

Human orthology & disease relationships

NCBI Entrez ID: 3932
Ensembl gene IDs: ENSG00000182866
Directly associated (OMIM) disease MIM numbers: 615758
Indirectly associated (Lage, et al.) disease MIM numbers: 101900,108500,124200,135300,170400,174050,176200,181000,193100,208000,209300,209880,211900,256800,308240,600995,601003,601382,601887,602475,604416,607832,607907,608957,608971,609307,609909

Library Location

Plate ID: GDExl11091
Well Location: B01

Sequences - 5ʹ (forward) EST

Accession: JZ838688
dbEST ID: 79656390
Trimmed Sequence: ATGGGATGTGGATGCAGCTCTGAGTATGAAGATGACTGGATTGAAAATTTTGATGTGTGTGAACACTGCCATCTTCCTAGGGAAAAGACTGAGCTTATCTCATGCATTGATAAGGACCCCTTGGTTTCATACACAGGCCAAAATCCACCCAGTTCTCCACTGCATGATAACCAGGTGGTGGCCTTGTATAATTATGAGCCTATGCATGCTGAAGATCTGGGGTTTGAGGCAGGAGAGAAGATGCACATTTTGGAGCAGAAAGGAGAATGGTGGAAGGCTAAGTCTCTCAGAACAGGACAGGTGGGATTCATACCACATAACTTTGTGGCATCCGAAAATGGCATTGAATCTGAACTGTGGTTTTTTAAAGATTTGGGTAGAAAAGATGCAGAACGACAAGCTTCTGGCTCCTGGAAATCAACAAGGATCCTTCCAAGTGAAGGAGAGTGAAACTAACAAAGGTTCCTGACTCTCTTTCTGGCAGAGAACAAGATCAGAATCACGGTAAGGTGGGGAAGGCTGTAATAGATTCGAAAATCGAAGAGTGGATGAATTTGCTTATCGCCTAAAAAAAATAGTTGAACGTAACGAGAAGGGGGTGAAGGTTTGCGGGGTATGCGGCGGTTGCGAAGAGAGACGCGCTTGGGAAAATATGGAGGGTGGGAGTGAGGATTTACCGATGGGAGAAGTTGAAGTGGGGGGGTGGGGAGAAGAGGGGGGGGGACGATGAGGGGAGTAGTAGATAAAGGTTGGGGGAAGTAGGGTGGGGGAGAGATGCATGTGGGATACGGTAGAT
Full Trace Sequence: CTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGATGTGGATGCAGCTCTGAGTATGAAGATGACTGGATTGAAAATTTTGATGTGTGTGAACACTGCCATCTTCCTAGGGAAAAGACTGAGCTTATCTCATGCATTGATAAGGACCCCTTGGTTTCATACACAGGCCAAAATCCACCCAGTTCTCCACTGCATGATAACCAGGTGGTGGCCTTGTATAATTATGAGCCTATGCATGCTGAAGATCTGGGGTTTGAGGCAGGAGAGAAGATGCACATTTTGGAGCAGAAAGGAGAATGGTGGAAGGCTAAGTCTCTCAGAACAGGACAGGTGGGATTCATACCACATAACTTTGTGGCATCCGAAAATGGCATTGAATCTGAACTGTGGTTTTTTAAAGATTTGGGTAGAAAAGATGCAGAACGACAAGCTTCTGGCTCCTGGAAATCAACAAGGATCCTTCCAAGTGAAGGAGAGTGAAACTAACAAAGGTTCCTGACTCTCTTTCTGGCAGAGAACAAGATCAGAATCACGGTAAGGTGGGGAAGGCTGTAATAGATTCGAAAATCGAAGAGTGGATGAATTTGCTTATCGCCTAAAAAAAATAGTTGAACGTAACGAGAAGGGGGTGAAGGTTTGCGGGGTATGCGGCGGTTGCGAAGAGAGACGCGCTTGGGAAAATATGGAGGGTGGGAGTGAGGATTTACCGATGGGAGAAGTTGAAGTGGGGGGGTGGGGAGAAGAGGGGGGGGGACGATGAGGGGAGTAGTAGATAAAGGTTGGGGGAAGTAGGGTGGGGGAGAGATGCATGTGGGATACGGTAGAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGATGTGGATGCAGCTC

Sequences - 3ʹ (reverse) EST

Accession: JZ838687
dbEST ID: 79656389
Trimmed Sequence: TGGCTGAGACTGATATTGGCCCTCAGTAGCTGTGAAGAAATCTTCAAGCAAGGATCGAAGAAATTCAAATGTAGGCCTTTCTTCAGGCTCTTCCTTCCAACAACGAACCATAAGTTCATACAATTCCATAGGACAGTTGTCTGGCTGAGGCATACGATACCCTCGTTCCAGATTTTCTATGACCTCTGGATTAGTCATGCCTGGGTACGGAATTCTTCCATAAGTGACAATTTCAGTCAGCAGTACACCAAATGACCACACATCTGATTTAATGGTGAAAGTCCCATAATTTATGGCTTCAGGGGCTGTCCATTTAATAGGAAATTTGGCTCCTTCTCTAGCTGTGTACTCATTGTCCACTATGATTCGAGCCAGTCCAAAATCAGCTATCTTGCAACACAGAGACTCAGATACGAGAATATTGGCAGCTCGCAGATCCCGGTGGATGTAATTCCTGCGCTCTAGGAAAGCCATTCCCTCTGAAACCTGAGCAGACATATCTATTAGTTTATAGATGGTTAATTTGAGACCTTCTGAGGTTTTTAAGTAATCCACAAGGCAACCATTCTCCATGTACTCTGTCACAATATATATTGGGCTCCTGAAGTTACAGCGGCATTTTAAACAAACCAATCCTTGGGGGGCTGGTGGGGGGTTTAGTTAGATTTACCTTCCCCCCCTACAAGGCCTTCCTGGTGAACAGGGGGGGCCGGAATTTGGAGGGCTTCTTTTTGGGGCGAGCGTTTTTGGTTTGGTCCCCCTTTTGGAGGTAGG
Full Trace Sequence: GGAAAAATGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGGCTGAGACTGATATTGGCCCTCAGTAGCTGTGAAGAAATCTTCAAGCAAGGATCGAAGAAATTCAAATGTAGGCCTTTCTTCAGGCTCTTCCTTCCAACAACGAACCATAAGTTCATACAATTCCATAGGACAGTTGTCTGGCTGAGGCATACGATACCCTCGTTCCAGATTTTCTATGACCTCTGGATTAGTCATGCCTGGGTACGGAATTCTTCCATAAGTGACAATTTCAGTCAGCAGTACACCAAATGACCACACATCTGATTTAATGGTGAAAGTCCCATAATTTATGGCTTCAGGGGCTGTCCATTTAATAGGAAATTTGGCTCCTTCTCTAGCTGTGTACTCATTGTCCACTATGATTCGAGCCAGTCCAAAATCAGCTATCTTGCAACACAGAGACTCAGATACGAGAATATTGGCAGCTCGCAGATCCCGGTGGATGTAATTCCTGCGCTCTAGGAAAGCCATTCCCTCTGAAACCTGAGCAGACATATCTATTAGTTTATAGATGGTTAATTTGAGACCTTCTGAGGTTTTTAAGTAATCCACAAGGCAACCATTCTCCATGTACTCTGTCACAATATATATTGGGCTCCTGAAGTTACAGCGGCATTTTAAACAAACCAATCCTTGGGGGGCTGGTGGGGGGTTTAGTTAGATTTACCTTCCCCCCCTACAAGGCCTTCCTGGTGAACAGGGGGGGCCGGAATTTGGAGGGCTTCTTTTTGGGGCGAGCGTTTTTGGTTTGGTCCCCCTTTTGGAGGTAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGGCTGAGACTGATATTGG