ORFeome > lct.1 ORF1 – XORFeome v1.0

lct.1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: lct.1
Gene ID: 5930998
Gene Page ID: 5930956
ORF Xenbase ID: 17281953

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC154965
Original XGC clone length: 1824

Human orthology & disease relationships

NCBI Entrez ID: 3938
Ensembl gene IDs: ENSG00000115850
Directly associated (OMIM) disease MIM numbers: 223000
Indirectly associated (Lage, et al.) disease MIM numbers: 111400,125851,175200,194200,223000,230200,230600,230650,230800,230900,231000,231005,235700,253010,600858,602485,607091,608013

Library Location

Plate ID: GDExl11092
Well Location: B06

Sequences - 5ʹ (forward) EST

Accession: JZ839038
dbEST ID: 79656740
Trimmed Sequence: ATGGACACTTTTGAATGGAATTCAGGCTACAGTGTACGGTTTGGTCTGCACCACGTGGACTTTAAAAATCCAAGCCGTCCAAGGACGCCCAAACGATCTGCCATCTACTACGCAGAAATCATACGGAACAAGGGCATGCCCCTTAGCAAGGAGGATGAGTTCCTTTATGGAGAGTTCTCAAAAGATTTTGCATGGAGTGTGGCATCTGCTTCCTACCAGATTGAAGGAGCCTGGAGGGCTGATGGCAAAAGCCTGAGTATCTGGGACCAGTATGCGCATACCCCATTGAGAATTGGGAATGATGACAATGGGGATATAGCTTGTGACAGCTACAACAGAATCGAGCAAGATGTGACTGCTCTGAAGAACCTCAAAGTCTCACACTATCGATTCTCAGTTTCTTGGTCACGGATTCTCCCAGACGGGACTCGGAACTTTGTTAATGAGGCTGGGCTAAATTATTATGTTCGTCTCATTGATGCTTTGTTAGTGGCCAATATATCACCACAGGTGACCTTATATCACTGGGATCTGCCCCAAGTGTTACAGAACATCGGAGGATGGGAAAATGACACCATTGTGGAAAAGTTTAAAGACTATGCTGACCTGCTCTTTCAGAAACTAGGGGACAAGGTGAAGTTCTGGATAACCAT
Full Trace Sequence: AGCGCGGTTAACTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGACACTTTTGAATGGAATTCAGGCTACAGTGTACGGTTTGGTCTGCACCACGTGGACTTTAAAAATCCAAGCCGTCCAAGGACGCCCAAACGATCTGCCATCTACTACGCAGAAATCATACGGAACAAGGGCATGCCCCTTAGCAAGGAGGATGAGTTCCTTTATGGAGAGTTCTCAAAAGATTTTGCATGGAGTGTGGCATCTGCTTCCTACCAGATTGAAGGAGCCTGGAGGGCTGATGGCAAAAGCCTGAGTATCTGGGACCAGTATGCGCATACCCCATTGAGAATTGGGAATGATGACAATGGGGATATAGCTTGTGACAGCTACAACAGAATCGAGCAAGATGTGACTGCTCTGAAGAACCTCAAAGTCTCACACTATCGATTCTCAGTTTCTTGGTCACGGATTCTCCCAGACGGGACTCGGAACTTTGTTAATGAGGCTGGGCTAAATTATTATGTTCGTCTCATTGATGCTTTGTTAGTGGCCAATATATCACCACAGGTGACCTTATATCACTGGGATCTGCCCCAAGTGTTACAGAACATCGGAGGATGGGAAAATGACACCATTGTGGAAAAGTTTAAAGACTATGCTGACCTGCTCTTTCAGAAACTAGGGGACAAGGTGAAGTTCTGGATAACCAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACACTTTTGAATGGAATTCA

Sequences - 3ʹ (reverse) EST

Accession: JZ839037
dbEST ID: 79656739
Trimmed Sequence: AAAGTTGCTCATTTTTGGTTTTTTTGCTAATTTTCTGTAGAAAACGGATAACAAGACAATTCCTAAAACCGCTGCAATTAGGAAGGCAAATTCCACGTAGAGAGCAACCTCGGCATCTGAGGGTGAAATCTCTAGTCCAAGGAAGGAAACGGCTTCTTCCTGGTTTTCACCGGAAGGTGGCGTGGTGACAGTGGGAGCAGTCGTACCTTCTGTTTCAGGCTCCAGACATGGAGGTGAGCCATTACTTGGGTCGGGGAAACCATTGCACAGAATGATAGATCTGTAGTACTTTGTTGACTTTTTAGGGATACGTGCCAATTCAGGATCTGAGTAGTTGGTGTAATGCAAGCCAAACCTTTCGGCAAATCCCGTGGCCCACTCAAAGTTATCCATCAAGGACCAGGCTGTGTAGCCACGCAGGTCCACCCCATCATATTTGACAGCTTTTAGAGCCTCGTTGATATATTCTTTGTAGTAATGTTCTCTCCAGACATCATTCAGGTCAGTGCCACGCTCAGAAATGCCGTTTTCTGTTACAGAATAAGAAGGGTTGTTATACTCTTCTTTTAATCCAGTTCAGTATCCTTCTGAAGCCAAATGGAGTGACTTTTAGCCAGAAGGAACCAGAGCCCAGCCAGCTTGTGATCATTGGTTGAAGCTACTCCCCCTGTCTGCATCGTATGTTCTGCTGCAAAATT
Full Trace Sequence: GCGCATTCNGTCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAAGTTGCTCATTTTTGGTTTTTTTGCTAATTTTCTGTAGAAAACGGATAACAAGACAATTCCTAAAACCGCTGCAATTAGGAAGGCAAATTCCACGTAGAGAGCAACCTCGGCATCTGAGGGTGAAATCTCTAGTCCAAGGAAGGAAACGGCTTCTTCCTGGTTTTCACCGGAAGGTGGCGTGGTGACAGTGGGAGCAGTCGTACCTTCTGTTTCAGGCTCCAGACATGGAGGTGAGCCATTACTTGGGTCGGGGAAACCATTGCACAGAATGATAGATCTGTAGTACTTTGTTGACTTTTTAGGGATACGTGCCAATTCAGGATCTGAGTAGTTGGTGTAATGCAAGCCAAACCTTTCGGCAAATCCCGTGGCCCACTCAAAGTTATCCATCAAGGACCAGGCTGTGTAGCCACGCAGGTCCACCCCATCATATTTGACAGCTTTTAGAGCCTCGTTGATATATTCTTTGTAGTAATGTTCTCTCCAGACATCATTCAGGTCAGTGCCACGCTCAGAAATGCCGTTTTCTGTTACAGAATAAGAAGGGTTGTTATACTCTTCTTTTAATCCAGTTCAGTATCCTTCTGAAGCCAAATGGAGTGACTTTTAGCCAGAAGGAACCAGAGCCCAGCCAGCTTGTGATCATTGGTTGAAGCTACTCCCCCTGTCTGCATCGTATGTTCTGCTGCAAAATT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAAGTTGCTCATTTTTGGTTT