ORFeome > ldb1 ORF1 – XORFeome v1.0

ldb1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ldb1
Gene ID: 866237
Gene Page ID: 493238
ORF Xenbase ID: 17281959

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044043
Original XGC clone length: 1128

Human orthology & disease relationships

NCBI Entrez ID: 8861
Ensembl gene IDs: ENSG00000198728
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 114480,142680,172800,180849,209950,219050,227650,600802,606764,606843

Library Location

Plate ID: GDExl11017
Well Location: H05

Sequences - 5ʹ (forward) EST

Accession: JZ824399
dbEST ID: 79642101
Trimmed Sequence: ATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATTTGGAGCCCGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACTTTTTGTTTGGAGGATGGACCAAAGAGATACACAATTGGACGGACGCTGATCCCGCGGTATTTCCGAAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAACACCCCAAGGAGTCATTCCACAATAATTTTGTTTCCCTCGACTGTGACCAGTGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGTGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGATGACATGATGAGGATAAAAACGTGGCACTTCAGTATCAGACAACATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAANAACATTACAAGATGCGGACTTTCCAACTCCACGCTTACTACCTCCGACTGTGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCAGGGCCAGACTTACAGGTTTAGTTCTCTCGAACTGTCTCAAGAACTGTCTCTTTAGAAATGCCAACCCAGGGTGGGCCCCCCCGGCGGGAACAACCCCAAACAACCCCCCCCCAGGCAAGGAAAAAGGAAAAATGTCCGGAGAGGCACCCCCC
Full Trace Sequence: AAAAATTGATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGGATCGAGATGTGGGACCCACCCCGATGTATCCACCAACATATTTGGAGCCCGGGATAGGGAGGCATACGCCATATGGGAACCAGACAGACTACAGAATATTTGAGCTGAACAAACGCTTGCAAAATTGGACAGAGGAATGTGACAATTTGTGGTGGGATGCTTTTACCACAGAGTTCTTTGAAGATGATGCAATGTTAACCATCACTTTTTGTTTGGAGGATGGACCAAAGAGATACACAATTGGACGGACGCTGATCCCGCGGTATTTCCGAAGCATCTTTGAGGGAGGAGCCACAGAGCTGTACTATGTCTTGAAACACCCCAAGGAGTCATTCCACAATAATTTTGTTTCCCTCGACTGTGACCAGTGCACAATGGTCACACAGCATGGCAAACCTATGTTCACACAGGTATGTGTAGAAGGCAGATTATACCTGGAGTTCATGTTCGATGACATGATGAGGATAAAAACGTGGCACTTCAGTATCAGACAACATCGAGAGCTCATTCCCCGGAGTATTCTAGCCATGCATGCCCAAGACCCCCAAATGTTGGACCAGTTGTCTAANAACATTACAAGATGCGGACTTTCCAACTCCACGCTTACTACCTCCGACTGTGTGTCATCCTAGAGCCCATGCAGGAGCTTATGTCAGGGCCAGACTTACAGGTTTAGTTCTCTCGAACTGTCTCAAGAACTGTCTCTTTAGAAATGCCAACCCAGGGTGGGCCCCCCCGGCGGGAACAACCCCAAACAACCCCCCCCCAGGCAAGGAAAAAGGAAAAATGTCCGGAGAGGCACCCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGGATCGAGATGTG

Sequences - 3ʹ (reverse) EST

Accession: JZ829756
dbEST ID: 79647458
Trimmed Sequence: CTGTGAAGCCTGTGAAGTTGGGTTCTCGGATTTACTTTCTTGACTTGAGGGGGGTTTGCTGTTCCATGGGCTGTTGGCGCCTAGTGCTGGCGAGTTATTGAAGCTGTCCTCGTCATCAATTCCATTGGCGGCGTCAAACTGAGTGTTCTCCAGGCGGGTTATGAGCCGTTCATCTTCATCTCCGAATTCTCCTCCCATCAGGGTTGGTTCGCCCACCACCATTACATCAGGTACCTGGCTGGAGAGGGCGAAGGTACTGGCTGGGCTCTTCTTTTTGCTGTTGCTGTTATTTGTGTTGCCCCCTCCAGAACTCATGGTGCTGCCTCCGGACATTTTCCTTTTCCTGCGCTTGCTGGGGGCTTGTCTGGCTGGTTCAGCCGGAGGTGCCACCATGCGTTGCCATTTCTGAAAGAGACAGGTCTTGAGACAGTCCCGAGGACTTAAACTGTAAGTCTTGTGCCTGGACATAAGCTCCTGCATGGGCTCTAGGATGACACACAGTCGGAGGTAGTTAAGCGTGGAGTTGGAAAGTCCGCATCTTGTAATGTTTTTAGACAACTGGTCCAACATTTGGGGGTCTTGGGCATGCATGGCTAGAATACTCCGGGGGATGAGCTCTCGATGTTGTCTGATACTGAAAGTGCACGGTTTTATCCTCATCATGTCATCGAACAATGAACTCCAAGGTATAATCTGCCTTTCCACCACATACCTGTGTTGAAACATAGGGTTTTGCCATGGCTGTGGTGAACCATT
Full Trace Sequence: CGGCGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGTGAAGCCTGTGAAGTTGGGTTCTCGGATTTACTTTCTTGACTTGAGGGGGGTTTGCTGTTCCATGGGCTGTTGGCGCCTAGTGCTGGCGAGTTATTGAAGCTGTCCTCGTCATCAATTCCATTGGCGGCGTCAAACTGAGTGTTCTCCAGGCGGGTTATGAGCCGTTCATCTTCATCTCCGAATTCTCCTCCCATCAGGGTTGGTTCGCCCACCACCATTACATCAGGTACCTGGCTGGAGAGGGCGAAGGTACTGGCTGGGCTCTTCTTTTTGCTGTTGCTGTTATTTGTGTTGCCCCCTCCAGAACTCATGGTGCTGCCTCCGGACATTTTCCTTTTCCTGCGCTTGCTGGGGGCTTGTCTGGCTGGTTCAGCCGGAGGTGCCACCATGCGTTGCCATTTCTGAAAGAGACAGGTCTTGAGACAGTCCCGAGGACTTAAACTGTAAGTCTTGTGCCTGGACATAAGCTCCTGCATGGGCTCTAGGATGACACACAGTCGGAGGTAGTTAAGCGTGGAGTTGGAAAGTCCGCATCTTGTAATGTTTTTAGACAACTGGTCCAACATTTGGGGGTCTTGGGCATGCATGGCTAGAATACTCCGGGGGATGAGCTCTCGATGTTGTCTGATACTGAAAGTGCACGGTTTTATCCTCATCATGTCATCGAACAATGAACTCCAAGGTATAATCTGCCTTTCCACCACATACCTGTGTTGAAACATAGGGTTTTGCCATGGCTGTGGTGAACCATT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGTGAAGCCTGTGAAGT