ORFeome > ldhb ORF1 – XORFeome v1.0

ldhb ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ldhb
Gene ID: 5908692
Gene Page ID: 5908186
ORF Xenbase ID: 17281983

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054257
Original XGC clone length: 1005

Human orthology & disease relationships

NCBI Entrez ID: 3945
Ensembl gene IDs: ENSG00000111716
Directly associated (OMIM) disease MIM numbers: 614128
Indirectly associated (Lage, et al.) disease MIM numbers: 102900,231670,245349,248600,266150,266200,312170,606054,607322

Library Location

Plate ID: GDExl11003
Well Location: D10

Sequences - 5ʹ (forward) EST

Accession: JZ839473
dbEST ID: 79657175
Trimmed Sequence: ATGTCTACTGTTCAGGAGAAACTGATCACTAATGTGTGCCAGGATAAGGCTGCCAAACCCACAAACAAGATAACGATCGTTGGGGTCGGACAAGTTGGCATGGCCTGCGCTGTCAGTGTCCTCCTGAAGGAGTTGGCCGATGAGCTTGCCCTGGTTGATATCTTGGAAGACAAACTTAAGGGTGGAGTGATGGATCTGCAACACGGTTCCCTGTTCCTCAAAACACCAACCATTGTAGCTGACAAAGATTATTCCGTAACCGCTAACTCCAGAATTGTTGTGGTAACTGGTGGGGTCCGCCAGCAGGAAGGAGAGAGCCGCCTGAACTTGGTCCAGAGGAACGTCAATGTCTTCAAGTTCATTATCCCTCAGGTTGTCAAGTACAGTCCTGACTGCATCATCATTGTGGTCTCCAATCCAGTGGACATCCTGACCTACGTAACCTGGAAACTGAGTGGCCTTCCCCAACACCGTATCATTGGCAGTGGGACCAACCTGGATTCTGCACGGTTTCGCCATCTGATTTCTGAGAAGCTTGGGGTTCACCCATCCAGTTGTCATGGCTTCATCCTGGGAGAACATGGAGATACCAGTGTGGCTGTCTGGAGTGGCGTTAATGTAGCTGGAGTCAGTCTTCAGTCCCTTAAACCTGAGATTGNCACTGACCAAGACTCTTGCACCTGGAAAAAAGTCACAAGAAGGTAGTTGACAGTGCCTATGAAGTGATCAAGCTTAAAGGCTACACCAACTGGGCCAATTGGCT
Full Trace Sequence: ATAAATCGATTTTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTACTGTTCAGGAGAAACTGATCACTAATGTGTGCCAGGATAAGGCTGCCAAACCCACAAACAAGATAACGATCGTTGGGGTCGGACAAGTTGGCATGGCCTGCGCTGTCAGTGTCCTCCTGAAGGAGTTGGCCGATGAGCTTGCCCTGGTTGATATCTTGGAAGACAAACTTAAGGGTGGAGTGATGGATCTGCAACACGGTTCCCTGTTCCTCAAAACACCAACCATTGTAGCTGACAAAGATTATTCCGTAACCGCTAACTCCAGAATTGTTGTGGTAACTGGTGGGGTCCGCCAGCAGGAAGGAGAGAGCCGCCTGAACTTGGTCCAGAGGAACGTCAATGTCTTCAAGTTCATTATCCCTCAGGTTGTCAAGTACAGTCCTGACTGCATCATCATTGTGGTCTCCAATCCAGTGGACATCCTGACCTACGTAACCTGGAAACTGAGTGGCCTTCCCCAACACCGTATCATTGGCAGTGGGACCAACCTGGATTCTGCACGGTTTCGCCATCTGATTTCTGAGAAGCTTGGGGTTCACCCATCCAGTTGTCATGGCTTCATCCTGGGAGAACATGGAGATACCAGTGTGGCTGTCTGGAGTGGCGTTAATGTAGCTGGAGTCAGTCTTCAGTCCCTTAAACCTGAGATTGNCACTGACCAAGACTCTTGCACCTGGAAAAAAGTCACAAGAAGGTAGTTGACAGTGCCTATGAAGTGATCAAGCTTAAAGGCTACACCAACTGGGCCAATTGGCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTACTGTTCAGGAGAAACT

Sequences - 3ʹ (reverse) EST

Accession: JZ839472
dbEST ID: 79657174
Trimmed Sequence: CAGGTCCTTCAGGTCTTTCTGGATGCCCCATAAGGTCTCTGCACTCTTCTGCAGCTGACCAACCTCATCATCCTTCAGCTTCTGGTTGATGACACTGGTCAATCCATTTCCATTCAGGACACGTGGGAGGCTCAAGAATACTTCAGTCTCAATGCCATACATGCCCTTCACCATTGTTGAAACTGGATGGACTCGGCCCAGGTTTTTAGTAATGGATTCTACTATTTCAGCCACGCTGAAGCCAATGGCCCAGTTGGTGTAGCCTTTAAGCTTGATCACTTCATAGGCACTGTCAACTACCTTCTTGTGAACTTCTTTCCAGTTGCAAGAGTCTTGGTCAGTGCCAATCTCAGGTTTAAGGGACTGAAGACTGACTCCAGCTACATTAACGCCACTCCAGACAGCCACACTGGTATCTCCATGTTCTCCCAGGATGAAGCCATGACAACTGGATGGGTGAACCCCAAGCTTCTCAGAAATCAGATGGCGAAACCGTGCAGAATCCAGGTTGGTCCCACTGCCCATGATACGGTGTTTGGGGAAGGCCACTCAGTTTCCAGGTTACGTAGGTCAGGATGTCCACTGGATTGGAGACCACATGATGATGCAGTCAGGACTGTACTTGACAACCTGA
Full Trace Sequence: CGAGCAACATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGGTCCTTCAGGTCTTTCTGGATGCCCCATAAGGTCTCTGCACTCTTCTGCAGCTGACCAACCTCATCATCCTTCAGCTTCTGGTTGATGACACTGGTCAATCCATTTCCATTCAGGACACGTGGGAGGCTCAAGAATACTTCAGTCTCAATGCCATACATGCCCTTCACCATTGTTGAAACTGGATGGACTCGGCCCAGGTTTTTAGTAATGGATTCTACTATTTCAGCCACGCTGAAGCCAATGGCCCAGTTGGTGTAGCCTTTAAGCTTGATCACTTCATAGGCACTGTCAACTACCTTCTTGTGAACTTCTTTCCAGTTGCAAGAGTCTTGGTCAGTGCCAATCTCAGGTTTAAGGGACTGAAGACTGACTCCAGCTACATTAACGCCACTCCAGACAGCCACACTGGTATCTCCATGTTCTCCCAGGATGAAGCCATGACAACTGGATGGGTGAACCCCAAGCTTCTCAGAAATCAGATGGCGAAACCGTGCAGAATCCAGGTTGGTCCCACTGCCCATGATACGGTGTTTGGGGAAGGCCACTCAGTTTCCAGGTTACGTAGGTCAGGATGTCCACTGGATTGGAGACCACATGATGATGCAGTCAGGACTGTACTTGACAACCTGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGGTCCTTCAGGTCTTT