ORFeome > lect1 ORF1 – XORFeome v1.0

lect1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: lect1
Gene ID: 489330
Gene Page ID: 489325
ORF Xenbase ID: 17282013

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043890
Original XGC clone length: 1017

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11012
Well Location: B11

Sequences - 5ʹ (forward) EST

Accession: JZ823973
dbEST ID: 79641675
Trimmed Sequence: ATGGCGGATACTTCGGAGAAAGTTCCTATTGCCCTTGCGGGTCCCGAGGACGTGGAGCAGTGTTTACCCCCTGCATACACAGCTGTGACAGTGAAGCCTTCCAGTAACAGCCGCCTACTCAGAATTGGAGCTGTGGTGCTGATCTCTGGGGCCCTTCTGCTTCTCTTTGGATCAATCGGAGCTTTTTACTTCTGGAAGCCAAATGACAAGCATGTTTACAATGTCCATTACACAATGAGCATCAATGGCAAGGTGCAAGAAGGATCTATGGAAATCGATTCTGGAAATAACTTGGAAACCTTCAAGACTGGCACTGGAAACGATGAAGCTGTGGAAGTGCATGACTTTCAGATTGGTATTACTGGCATTCGCTTCACTGGAGGAGAGAAGTGCTACATTAAAGCTCAAGCCAAGGCTCACATCCCCGATGTCGACAGTGTGACAAAAGAAGGTCTCTCGTTTGAGCTGGAAGATGAGATCATGCCGGCAAAGTTTGATGAAAATTCCCTTATCTGGGTGGCGGCAGACCAGCCTGTAAAAGACAGCAGCTTTCTGAGCCCGAAAATCCAGGAACTTTGCGCCGACCTTCCAATCTTTTGGCTCCGTCCTACATACCCAAAAGAACATCAAAGAGGTAAAAGGGAGACGGGTAGAAAGGTCAGACAAGCTCAGAGTCCGTTTGAAGTTGCCGCAGAAGAAAGGAATACTAGACGCCCAAGGCATC
Full Trace Sequence: CAATATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGATACTTCGGAGAAAGTTCCTATTGCCCTTGCGGGTCCCGAGGACGTGGAGCAGTGTTTACCCCCTGCATACACAGCTGTGACAGTGAAGCCTTCCAGTAACAGCCGCCTACTCAGAATTGGAGCTGTGGTGCTGATCTCTGGGGCCCTTCTGCTTCTCTTTGGATCAATCGGAGCTTTTTACTTCTGGAAGCCAAATGACAAGCATGTTTACAATGTCCATTACACAATGAGCATCAATGGCAAGGTGCAAGAAGGATCTATGGAAATCGATTCTGGAAATAACTTGGAAACCTTCAAGACTGGCACTGGAAACGATGAAGCTGTGGAAGTGCATGACTTTCAGATTGGTATTACTGGCATTCGCTTCACTGGAGGAGAGAAGTGCTACATTAAAGCTCAAGCCAAGGCTCACATCCCCGATGTCGACAGTGTGACAAAAGAAGGTCTCTCGTTTGAGCTGGAAGATGAGATCATGCCGGCAAAGTTTGATGAAAATTCCCTTATCTGGGTGGCGGCAGACCAGCCTGTAAAAGACAGCAGCTTTCTGAGCCCGAAAATCCAGGAACTTTGCGCCGACCTTCCAATCTTTTGGCTCCGTCCTACATACCCAAAAGAACATCAAAGAGGTAAAAGGGAGACGGGTAGAAAGGTCAGACAAGCTCAGAGTCCGTTTGAAGTTGCCGCAGAAGAAAGGAATACTAGACGCCCAAGGCATC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGATACTTCGGAGAAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829282
dbEST ID: 79646984
Trimmed Sequence: GACGATGCCTAAGATACGTGCAACCCACCAGCTGCAAGGCATGACAATTCTACATGCGGAGCGACACCCTTGGTAGTTGTAAGGCCATGGATCATATCCGCCTAGTGGTTCACAGATCCTCTGACAATGGGTGTAACTTCTCCTGCAATCAATGCAGCACACGCCTTGGTGGTCCAGCATGGGGTTAAATGTCATCCCGCCTTCTCCTTCCAGGTGATAGGGGTTCTCTGGGTTGAAGGGAGTTTCTTGCTCAGAAGTTGTCTGTGTTTCATTAACTGCTTGGGCTCTGCGATTGCCTTGGCGTCTAGTATTCCTTTCTTCTGCGGCAACTTCAAACGGACTCTGAGCTTGTCTGACCTTTCTACCCGTCTCCCTTTTACCTCTTTGATGTTCTTTTGGGTATGTAGGACGGAGCCAAAAGATTGGAAGGTCGGCGCAAAGTTCCTGGATTTTCGGGCTCAGAAAGCTGCTGTCTTTTACAGGCTGGTCTGCCGCCACCCAGATAAGGGAATTTTCATCAAACTTTGCCGGCATGATCTCATCTTCCAGCTCAAACGAGAGACCTTCTTTTGTCACACTGTCAACATCGGGGATGTGAGCCCTTGGCTTGAGCTTTAATGTAGCACTTCTCTCCCTCCGTGAACCGAAGGCCAGTTAATACCAATCTGAAAAGTCATGCCACTTCCCAAGCTTCCCTCGTTTTCCCGGGGCCAGTTCCTTTGAAGGGTTTCCCAAATTTTATTTTTCCAGAAA
Full Trace Sequence: GGCCAGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGACGATGCCTAAGATACGTGCAACCCACCAGCTGCAAGGCATGACAATTCTACATGCGGAGCGACACCCTTGGTAGTTGTAAGGCCATGGATCATATCCGCCTAGTGGTTCACAGATCCTCTGACAATGGGTGTAACTTCTCCTGCAATCAATGCAGCACACGCCTTGGTGGTCCAGCATGGGGTTAAATGTCATCCCGCCTTCTCCTTCCAGGTGATAGGGGTTCTCTGGGTTGAAGGGAGTTTCTTGCTCAGAAGTTGTCTGTGTTTCATTAACTGCTTGGGCTCTGCGATTGCCTTGGCGTCTAGTATTCCTTTCTTCTGCGGCAACTTCAAACGGACTCTGAGCTTGTCTGACCTTTCTACCCGTCTCCCTTTTACCTCTTTGATGTTCTTTTGGGTATGTAGGACGGAGCCAAAAGATTGGAAGGTCGGCGCAAAGTTCCTGGATTTTCGGGCTCAGAAAGCTGCTGTCTTTTACAGGCTGGTCTGCCGCCACCCAGATAAGGGAATTTTCATCAAACTTTGCCGGCATGATCTCATCTTCCAGCTCAAACGAGAGACCTTCTTTTGTCACACTGTCAACATCGGGGATGTGAGCCCTTGGCTTGAGCTTTAATGTAGCACTTCTCTCCCTCCGTGAACCGAAGGCCAGTTAATACCAATCTGAAAAGTCATGCCACTTCCCAAGCTTCCCTCGTTTTCCCGGGGCCAGTTCCTTTGAAGGGTTTCCCAAATTTTATTTTTCCAGAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGACGATGCCTAAGATACGTGCAA