ORFeome > leng9 ORF1 – XORFeome v1.0

leng9 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: leng9
Gene ID: 6254322
Gene Page ID: 961717
ORF Xenbase ID: 17282031

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078625
Original XGC clone length: 1296

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: B03

Sequences - 5ʹ (forward) EST

Accession: JZ839618
dbEST ID: 79657320
Trimmed Sequence: ATGGAGGACACAGGCACATCACAAGATGTCCCAAACGGTGATACCAACTCAGAAGTGGATCCCCCTCACTCAGAAAGTGAAACAGATCCTTTAACAAATTCTTCTGGGACATCGGCTGAGGGTGTTCCATGCCAGTTCTTTCTACTGGGGCGCTGCAGATTTGGAGAAAGGTGTAGAAACGTGCACCCAGAATCGCTGCAGAACTCCCAACCTGAAAGTAAAGCAAAAACAAAAGAAAAAAGGTCTGAACCAAATGCAAAGAAGCCGCCAATGAAGACTGCAGCAGATGTCATCTCACGAATTCAGTGGGACCCGAACTTACCCAAGGAGCATTTTCTGATCGGTTATCTGGATAGGTTTTTGGGCATTATTGAAAAGCCCTATTCTGCTTTCTGTTGGGAAGATTTGGCTTCAGTAGGGCATGATGTCCTCGCTATACCCAAGCATCGCATTCAGTACTTCAAGTACCAGCGTCTGGTGGTATGGGACAAAACCTCCCGCACGGACAATGTTTTTGGCTCAACTGGGAGTGGTCTCACAATATTAGATATCATCGACCAATACGAAGCACTGGCACCGGAGCAACCTGAAACGGCAAATCCGGATGAAGCAATTTCACCCGACACAGAAGATACGGAAACGAGGAATGACTTTGGCGCCNGTGAACGTAGCANTGATATTGATGAGAATGATGGGAAAAGCAGGCCCACTCAATTCGGTGGCAGTGCGTATTAGGCAGCGATGAACGTAAAAAATGCTGTAAAGGGAAATACAAAATGTACCTGCTGGGGAAACATCCCCGGGAACTTGGAAAAAATTTTTGGGTCCCCGGTA
Full Trace Sequence: GGCCCCATATAATGGAATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGACACAGGCACATCACAAGATGTCCCAAACGGTGATACCAACTCAGAAGTGGATCCCCCTCACTCAGAAAGTGAAACAGATCCTTTAACAAATTCTTCTGGGACATCGGCTGAGGGTGTTCCATGCCAGTTCTTTCTACTGGGGCGCTGCAGATTTGGAGAAAGGTGTAGAAACGTGCACCCAGAATCGCTGCAGAACTCCCAACCTGAAAGTAAAGCAAAAACAAAAGAAAAAAGGTCTGAACCAAATGCAAAGAAGCCGCCAATGAAGACTGCAGCAGATGTCATCTCACGAATTCAGTGGGACCCGAACTTACCCAAGGAGCATTTTCTGATCGGTTATCTGGATAGGTTTTTGGGCATTATTGAAAAGCCCTATTCTGCTTTCTGTTGGGAAGATTTGGCTTCAGTAGGGCATGATGTCCTCGCTATACCCAAGCATCGCATTCAGTACTTCAAGTACCAGCGTCTGGTGGTATGGGACAAAACCTCCCGCACGGACAATGTTTTTGGCTCAACTGGGAGTGGTCTCACAATATTAGATATCATCGACCAATACGAAGCACTGGCACCGGAGCAACCTGAAACGGCAAATCCGGATGAAGCAATTTCACCCGACACAGAAGATACGGAAACGAGGAATGACTTTGGCGCCNGTGAACGTAGCANTGATATTGATGAGAATGATGGGAAAAGCAGGCCCACTCAATTCGGTGGCAGTGCGTATTAGGCAGCGATGAACGTAAAAAATGCTGTAAAGGGAAATACAAAATGTACCTGCTGGGGAAACATCCCCGGGAACTTGGAAAAAATTTTTGGGTCCCCGGTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGACACAGGCACATCACAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839617
dbEST ID: 79657319
Trimmed Sequence: ATATAAATTTAACTCTAAAAGTGTTGTATAGAAGCCGTCAGTGCGCCTCGTACTACCAGCGTAGCAGAAACTGAGACTATCAACATGTTGAGCACCAAAGTGTGTAACTGGGGTGGTGTTATAGACTTGTGGAGAAAAGGCAAGGTTGGGCTGCTTCCTTAAAACTTTCATGGGTATTTTTGCTATTGTTACATGAAAGATGCTGGACCTTTGGGAGTCTACAACCCTTAGACCTTTGCTCCGAAAACTCTTCTGAAGATCGTGAGTAAATTTCTCTAATGCTGGAACAGCCGAAGGTGCTAAATAAAGCACACGGGAATGAAAGTCCCGCACCCCTTCAAAACTGAGAATGAGGCTCGGTGGGAGAGTCCGTTGCATTTCATGCTTCAGTTCTTGCAGCGTTAGAAGAGCACTTTCAATATCTTCTGCGCTTTCCAAATACAAGAGGCACAATGTTAAATGAAGGGTTTGTACAGGGACACAAAACTCTTCCAGCTCAGGATTGTTTCCCAGCAGTACATTTTGTATTTCCTTTACAGCATTTCTTACGTCATCGCTGCTAATACGCACTGCCACGAAATGAGTGGGCCTGCTTTTCCATCATTCTCATCAATATCATTGCTACGTTCACTGGGCGCCCAATTCATTCCTCGTTTCCGTATCTTCCTGTGTCGGGTGGAATTGGCTTCATCCGGAATTGCCCTTTTCAGGTTTGCTCCGGGGGGCCAGTGCCTCCCATATGGGTGCAATAAATTTCTAAAAATTGGTGAAAAAACAC
Full Trace Sequence: AAAACTGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATATAAATTTAACTCTAAAAGTGTTGTATAGAAGCCGTCAGTGCGCCTCGTACTACCAGCGTAGCAGAAACTGAGACTATCAACATGTTGAGCACCAAAGTGTGTAACTGGGGTGGTGTTATAGACTTGTGGAGAAAAGGCAAGGTTGGGCTGCTTCCTTAAAACTTTCATGGGTATTTTTGCTATTGTTACATGAAAGATGCTGGACCTTTGGGAGTCTACAACCCTTAGACCTTTGCTCCGAAAACTCTTCTGAAGATCGTGAGTAAATTTCTCTAATGCTGGAACAGCCGAAGGTGCTAAATAAAGCACACGGGAATGAAAGTCCCGCACCCCTTCAAAACTGAGAATGAGGCTCGGTGGGAGAGTCCGTTGCATTTCATGCTTCAGTTCTTGCAGCGTTAGAAGAGCACTTTCAATATCTTCTGCGCTTTCCAAATACAAGAGGCACAATGTTAAATGAAGGGTTTGTACAGGGACACAAAACTCTTCCAGCTCAGGATTGTTTCCCAGCAGTACATTTTGTATTTCCTTTACAGCATTTCTTACGTCATCGCTGCTAATACGCACTGCCACGAAATGAGTGGGCCTGCTTTTCCATCATTCTCATCAATATCATTGCTACGTTCACTGGGCGCCCAATTCATTCCTCGTTTCCGTATCTTCCTGTGTCGGGTGGAATTGGCTTCATCCGGAATTGCCCTTTTCAGGTTTGCTCCGGGGGGCCAGTGCCTCCCATATGGGTGCAATAAATTTCTAAAAATTGGTGAAAAAACAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATATAAATTTAACTCTA