ORFeome > leprel4 ORF1 – XORFeome v1.0

leprel4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: leprel4
Gene ID: 6254573
Gene Page ID: 1007099
ORF Xenbase ID: 17282055

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078077
Original XGC clone length: 1287

Human orthology & disease relationships

NCBI Entrez ID: 10609
Ensembl gene IDs: ENSG00000141696
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 112600,121850,133780,137800,153480,158350,168600,176807,176920,261550,276950,300555,309000,605909,608089

Library Location

Plate ID: GDExl11043
Well Location: H05

Sequences - 5ʹ (forward) EST

Accession: JZ828193
dbEST ID: 79645895
Trimmed Sequence: ATGTTGCTCCTCTCGCTGCTGCTGCTGCTCGTGGTGTCCCGGTGCGGAGCTCAGTACGAACAGTACAGTTTCCGCGGGTTCCCCCGGTCGGAGGTGCGGCCCCTGCAGGCCACTTATGGCCGCGCTCTGGAGCTGTACGAGGGGGACAAGTGGAAGGAGGCGGCCCGGGCGCTGGAGAACAGTCTGAGGCTTCACCGGCTGCTCCGGGACAGTGAGGCGCATTGCGGACACTCTTGCTCCGCGGGGGACGACGAAAGTCCAGTCCTGGAGAAGAAGGAGGAGGAGCAGGAGTGGAGGCGGGAGCTGCGGCTGTTCGGCCGAGTCTTGGCCAGAGCCGTGTGTCTGACGAAGTGTAAGGGGAGCCTGGCGGTCTTCCAGCAGCCCCACCCCGACCCCGACACTCTCAGCGCCATCCGACGCCGGGACCCCTATCACTATCTGCACTACTCCTACTTCAAGACCAATGAACTGGAGAAAGCAGTGTCGGCCGCCCACACGTTCCTGCGTAACAATCCGACCCACGAGATGACGCTCAAGTACATGAATTACTACAAAACTCTGATGGAAGTGGAGGAATATCTCATAGACCTGGAGGCGGAGCCTTACGAGGGGATGTTTGTGAAGGCAGTGAAAACGTACAATGCGGGGGATTTCAGGGCCCAGTACTGAAGATATAGGAACAGGGCGCTTCCCCCTTTTACTACCAGGCCCTATAACCAGCTGGCCTGAACGGCCCTGGCAAGGGAAACCTAAATCAAAATAAAAAAAAATTTTCAAAAAAATTTTCCAACCCCCGGGCCAGTTTG
Full Trace Sequence: GGGTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTGCTCCTCTCGCTGCTGCTGCTGCTCGTGGTGTCCCGGTGCGGAGCTCAGTACGAACAGTACAGTTTCCGCGGGTTCCCCCGGTCGGAGGTGCGGCCCCTGCAGGCCACTTATGGCCGCGCTCTGGAGCTGTACGAGGGGGACAAGTGGAAGGAGGCGGCCCGGGCGCTGGAGAACAGTCTGAGGCTTCACCGGCTGCTCCGGGACAGTGAGGCGCATTGCGGACACTCTTGCTCCGCGGGGGACGACGAAAGTCCAGTCCTGGAGAAGAAGGAGGAGGAGCAGGAGTGGAGGCGGGAGCTGCGGCTGTTCGGCCGAGTCTTGGCCAGAGCCGTGTGTCTGACGAAGTGTAAGGGGAGCCTGGCGGTCTTCCAGCAGCCCCACCCCGACCCCGACACTCTCAGCGCCATCCGACGCCGGGACCCCTATCACTATCTGCACTACTCCTACTTCAAGACCAATGAACTGGAGAAAGCAGTGTCGGCCGCCCACACGTTCCTGCGTAACAATCCGACCCACGAGATGACGCTCAAGTACATGAATTACTACAAAACTCTGATGGAAGTGGAGGAATATCTCATAGACCTGGAGGCGGAGCCTTACGAGGGGATGTTTGTGAAGGCAGTGAAAACGTACAATGCGGGGGATTTCAGGGCCCAGTACTGAAGATATAGGAACAGGGCGCTTCCCCCTTTTACTACCAGGCCCTATAACCAGCTGGCCTGAACGGCCCTGGCAAGGGAAACCTAAATCAAAATAAAAAAAAATTTTCAAAAAAATTTTCCAACCCCCGGGCCAGTTTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTGCTCCTCTCGCTGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ828192
dbEST ID: 79645894
Trimmed Sequence: GAAATATCCTTTTTCCGCAACGACCCCGTTAGATTTAGGCTCCGTCAACCAATTAGCAAGGATCCCTTCTTCGTAGTCCCCTTCCCCTTCAAACTCACTGTCACTGGGAGATGCTTCTTTTTCCTCCTCTGCTCCTACTTCCATCTCGTCGTCGTCTTGATAGAGGAAATCTTTGGCAAACTGCAAGAGCTCCTTGTGTCTAGTCGTCTGGCTGTGATACCGCAAAGCCTCCTCTCTGGGATTGAAATCTGTATCCTCCAAGTCCCATTTCTCCTTATAGAACCTGTAATAGGCCAGGTTTTGCTGCATGACCGTGTCATCGGGATCAAAGAGCATGTAGCTGGAGACGCACTGCACGGCGTTCTTCACATCGTTCAACTTGTAATAGGCAAACTGCAGGTAATGGTACATTGTAGCCACAAACTTCTGCACCAAGTAGCCTCCCACGTTGGGGATCAGGTTGGACTCACACTCCACTTTGCAGTGCAGCACGTCTGTCACGTGATCTGCAACTGCCGGGTAGAAGTCTTTGAACTCTCTCATCTGATAGGCTCCCTCGCAGGCCGTCAGGCAGCTGTTATAGGCCTTGTAGTAAAAGGCAGCGCCCGTTCCCTCTCCTCCGAACTGGCTCTGGAAATCCCCCGCAATGGACCTTCCTCACCTGCCCTCACAACCATCCCCTCCAAAAGGCTTCCACCCCCCCGGTCCATTAAAATAATTCCTCCCCCCTTCCCCTCCAAAATTTTTGGTAAA
Full Trace Sequence: GGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGGAAATATCCTTTTTCCGCAACGACCCCGTTAGATTTAGGCTCCGTCAACCAATTAGCAAGGATCCCTTCTTCGTAGTCCCCTTCCCCTTCAAACTCACTGTCACTGGGAGATGCTTCTTTTTCCTCCTCTGCTCCTACTTCCATCTCGTCGTCGTCTTGATAGAGGAAATCTTTGGCAAACTGCAAGAGCTCCTTGTGTCTAGTCGTCTGGCTGTGATACCGCAAAGCCTCCTCTCTGGGATTGAAATCTGTATCCTCCAAGTCCCATTTCTCCTTATAGAACCTGTAATAGGCCAGGTTTTGCTGCATGACCGTGTCATCGGGATCAAAGAGCATGTAGCTGGAGACGCACTGCACGGCGTTCTTCACATCGTTCAACTTGTAATAGGCAAACTGCAGGTAATGGTACATTGTAGCCACAAACTTCTGCACCAAGTAGCCTCCCACGTTGGGGATCAGGTTGGACTCACACTCCACTTTGCAGTGCAGCACGTCTGTCACGTGATCTGCAACTGCCGGGTAGAAGTCTTTGAACTCTCTCATCTGATAGGCTCCCTCGCAGGCCGTCAGGCAGCTGTTATAGGCCTTGTAGTAAAAGGCAGCGCCCGTTCCCTCTCCTCCGAACTGGCTCTGGAAATCCCCCGCAATGGACCTTCCTCACCTGCCCTCACAACCATCCCCTCCAAAAGGCTTCCACCCCCCCGGTCCATTAAAATAATTCCTCCCCCCTTCCCCTCCAAAATTTTTGGTAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATATCCTTTTTCTGCAACGTCC